ID: 1076689341

View in Genome Browser
Species Human (GRCh38)
Location 10:132213336-132213358
Sequence CTGTGGGTGTGTTGGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076689341_1076689352 13 Left 1076689341 10:132213336-132213358 CCATCTTCCCAACACACCCACAG 0: 1
1: 0
2: 6
3: 70
4: 730
Right 1076689352 10:132213372-132213394 TGACAGGGATTCCAGCAGAGAGG No data
1076689341_1076689353 14 Left 1076689341 10:132213336-132213358 CCATCTTCCCAACACACCCACAG 0: 1
1: 0
2: 6
3: 70
4: 730
Right 1076689353 10:132213373-132213395 GACAGGGATTCCAGCAGAGAGGG No data
1076689341_1076689348 -3 Left 1076689341 10:132213336-132213358 CCATCTTCCCAACACACCCACAG 0: 1
1: 0
2: 6
3: 70
4: 730
Right 1076689348 10:132213356-132213378 CAGGGCCTCCGCAGTGTGACAGG No data
1076689341_1076689349 -2 Left 1076689341 10:132213336-132213358 CCATCTTCCCAACACACCCACAG 0: 1
1: 0
2: 6
3: 70
4: 730
Right 1076689349 10:132213357-132213379 AGGGCCTCCGCAGTGTGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076689341 Original CRISPR CTGTGGGTGTGTTGGGAAGA TGG (reversed) Intronic
900252514 1:1678494-1678516 CTGGCGGTGTGATGGGCAGACGG - Intronic
900436808 1:2634846-2634868 CTGTGTGGGTGTTGGGGGGATGG - Intergenic
900962858 1:5936830-5936852 CTGTGGCTTTGTTGGAAACAAGG + Intronic
901083066 1:6594328-6594350 CTCTGGGCTTGTTGAGAAGAGGG - Intronic
901453057 1:9347874-9347896 CTGTGGGTGTGTGTTGAAGGGGG - Intronic
901886842 1:12229724-12229746 CTGTGGGTGAGTGGGCCAGACGG + Intergenic
902717364 1:18281914-18281936 TTGGGGGTGTGGTGGAAAGAGGG + Intronic
903183342 1:21616126-21616148 GTGTGTGTGTGTTGGGAAGAGGG - Intronic
903343212 1:22667906-22667928 GTGTGTGTGTGTTGGGTAGGGGG - Intergenic
903741808 1:25562736-25562758 TTGTGGGTGTGGTGGGAGGTGGG + Intronic
904287835 1:29463531-29463553 CTGTGTGTGTGGTGGGCAGGGGG - Intergenic
904521736 1:31101184-31101206 CTGTGCGTGTGCTGGGAGAAAGG - Intergenic
904613385 1:31737168-31737190 CTGGGTGTGTGTTGGGCAGGTGG - Intronic
904812945 1:33175589-33175611 CAGTTGGCGTGTTGGGAAGGAGG + Intronic
904876851 1:33661932-33661954 CTGTGTGTGTGGTGGGAGGGAGG - Intronic
904887029 1:33746646-33746668 CTGTGTATGTGTTGGGGAGAGGG - Intronic
905078671 1:35297368-35297390 CTGAGGGTGAGATGGGAGGATGG + Intronic
905264535 1:36742219-36742241 CTTTCTGTGTGTTGGGATGATGG - Intergenic
906130064 1:43450658-43450680 CTGTGGGTGTTTGGGGAGGGCGG - Exonic
906130387 1:43452145-43452167 CTGTGGGTGTGCGGAGAAGGGGG - Exonic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
906346034 1:45014937-45014959 CAGGGAGTGTGTGGGGAAGACGG + Exonic
906508450 1:46397051-46397073 CTGTGCTTGTGTAGGGGAGATGG - Intronic
906674165 1:47681235-47681257 CAGTGAGTGTGTTGGGTGGACGG + Intergenic
907250992 1:53139418-53139440 CCCTGTGTGTGTTGGGGAGAGGG - Intronic
907661460 1:56396593-56396615 CTGTTGGTGTGTAGGAGAGAAGG - Intergenic
908222757 1:62024647-62024669 GTGTGTGTGTGTTGGGAGGTGGG - Intronic
908928909 1:69292163-69292185 GTGTGTGTGTGTAGGGAAGCTGG + Intergenic
909907335 1:81214127-81214149 GTGTGTGTGTGTTGGAGAGAGGG + Intergenic
910144263 1:84060599-84060621 CTGTGCTTTTGTTGGTAAGAAGG + Intergenic
910382546 1:86644392-86644414 CTGTGGGAGTGTTAGAAAAATGG - Intergenic
910451552 1:87351754-87351776 GTGTGGGTGGGTAGGGCAGAGGG - Intergenic
910640584 1:89457185-89457207 CTTTGGGTGAGTAGGGCAGATGG + Intergenic
911027223 1:93448300-93448322 CTGTGGGTGAGTCGGGGAGAGGG + Exonic
912200500 1:107452490-107452512 CTGTGGTAGTATTGGGAAGTGGG + Intronic
912269813 1:108197843-108197865 ATGTGGCCGTGTTGGGAGGAGGG + Intronic
912451717 1:109771498-109771520 GTGTGTCTGTGTTGGGATGAGGG + Intronic
912526016 1:110283255-110283277 ATGTGGCGGTGTTGGGAAGTGGG - Intergenic
912552595 1:110493972-110493994 CTGAGTGTGTGCTGGGAAGGGGG - Intergenic
912669415 1:111610523-111610545 GTGTGTGTGTGTTGGGTGGAGGG - Intronic
912823478 1:112885596-112885618 CTGAGGGTGAGCTGGGAAGAAGG - Intergenic
913318898 1:117575245-117575267 CTGTGGGAGTCTAGGGAAGGGGG - Intergenic
913461134 1:119087020-119087042 GTGTGGGTGTGTTTGGTAGGAGG - Intronic
915141575 1:153771552-153771574 GCGTGTGTGTGTTGGGAAGGAGG - Intronic
915528455 1:156490148-156490170 CTGTGTGTGGGATGGGGAGAGGG - Intronic
915848924 1:159299979-159300001 GTGGGGGTGGGCTGGGAAGATGG + Intronic
916035558 1:160919364-160919386 CTGTTGGTGGGTGGGGAAAAAGG - Intergenic
916549570 1:165837130-165837152 ATGTGGCAGTGTTGGGAAGTGGG - Intronic
916833219 1:168514135-168514157 CTGTTGGTGTTATGGGTAGATGG + Intergenic
916898835 1:169198701-169198723 CTGAGGGTGAGGTGGGAAGTAGG + Intronic
917245398 1:172995641-172995663 GTGTGGATGTGTTGAGGAGAAGG - Intergenic
917779002 1:178371313-178371335 GTGTGTGTGTGTGGGAAAGAAGG - Intronic
917801408 1:178573844-178573866 CTGTGGGTGTATGGGGAGCAGGG - Intergenic
918000099 1:180485635-180485657 TTGTGGAGGTGTTGGAAAGAAGG - Intronic
918212436 1:182362999-182363021 CTGGGGGTGTGTTGGGAGGTGGG - Intergenic
918497581 1:185157235-185157257 GTGTGTGTGTGTTGGGAGGCGGG + Exonic
918667189 1:187166317-187166339 TTGTGGTGGTGTTGGGAAGTGGG + Intergenic
919841691 1:201614029-201614051 CTGGGTGGGGGTTGGGAAGATGG + Intergenic
920035010 1:203059995-203060017 ATGTGTGTGTGTTGGGGAGGGGG - Intronic
920363672 1:205436581-205436603 CTGTGTTTGTGTTGGGAGCAGGG + Intronic
920534842 1:206730762-206730784 CTGTGAGTGTGCTGGGGAGGGGG + Exonic
920675397 1:208034629-208034651 ATGTAGGTGTCTTGGGAAGTTGG + Intronic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
921911028 1:220549076-220549098 CTGTGCTTGTGTGGGGAATAGGG + Intronic
921956973 1:220994884-220994906 CTGTGGATGTGGTGGGGAGAAGG + Intergenic
922212661 1:223497635-223497657 ATGGGGGTGTGCTGGGAGGAGGG + Intergenic
922305466 1:224340594-224340616 CTGTGGGTGTTTCTCGAAGAGGG - Intergenic
923048028 1:230369622-230369644 CTGTGTGTGTGCTGGGGACAGGG + Intronic
923369338 1:233295274-233295296 CTGTGGGTATGGAGGGAAGAAGG - Intronic
924155260 1:241168748-241168770 ATGTGTGTGTGTTGGGGAGGTGG - Intronic
924729220 1:246696800-246696822 CTGTGTGTGTGTGGTGAGGAGGG + Intergenic
1063470686 10:6282409-6282431 CAGTGTGTCTGTTGGGAACATGG + Intergenic
1063718854 10:8558152-8558174 CTGTGTAGGTGTTGGAAAGAGGG - Intergenic
1063724481 10:8621832-8621854 CTGGGGGTGTGGTGGGAGGGTGG - Intergenic
1064017645 10:11785027-11785049 ATGTGGCTGTGTTGGAAAGGGGG - Intergenic
1064354113 10:14602990-14603012 GTGTGTGTGTGTGGGAAAGAGGG - Intronic
1065775474 10:29115699-29115721 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
1065790093 10:29252722-29252744 CTGGGTATGTGTTGGGAATAGGG + Intergenic
1065997622 10:31074102-31074124 TTGTGGATGTGGAGGGAAGACGG - Intergenic
1066352801 10:34652367-34652389 ATATGGGTGTGATGGGGAGAGGG + Intronic
1066517911 10:36184576-36184598 CAGTGAGTGTGTTGGGACTAGGG - Intergenic
1067561601 10:47308508-47308530 CTTTGTTTCTGTTGGGAAGAAGG - Intronic
1067732871 10:48825104-48825126 CAGTGGGTGGGGTGGGGAGAGGG - Intronic
1067922023 10:50468963-50468985 ATGTGTGTGTGTTGGGTAAAGGG + Intronic
1068153691 10:53168539-53168561 ATGTGGAAGTGTTGGGAAGTGGG + Intergenic
1068916436 10:62437167-62437189 CTGTGGGTGTTTTGGAAAATAGG + Intronic
1070128722 10:73641883-73641905 CTGTGGGTGTATTTGGAGCAGGG + Intergenic
1070869369 10:79736706-79736728 CTGTCAGCGGGTTGGGAAGAGGG - Intergenic
1070889929 10:79935732-79935754 ATGTAGGAGTGTCGGGAAGAGGG + Intergenic
1070937443 10:80312037-80312059 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1071129213 10:82371947-82371969 TTGTGGGGGTGTTGGGAGGAGGG - Intronic
1071334499 10:84589864-84589886 CTGTGCGGGTGTAGGGAAGGTGG + Intergenic
1071636288 10:87258912-87258934 CTGTCAGCGGGTTGGGAAGAGGG - Intergenic
1071658953 10:87479039-87479061 CTGTCAGCGGGTTGGGAAGAGGG + Intergenic
1071843529 10:89498225-89498247 GTGGGGGTGAGGTGGGAAGATGG + Intronic
1072038935 10:91589767-91589789 CTGGGGGAGTGTGGGGGAGAAGG + Intergenic
1073403779 10:103278859-103278881 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1073595976 10:104800564-104800586 GTGTGTGTGTGTTGGGGAGGCGG + Intronic
1073858025 10:107699841-107699863 CTGTGGGTGAGGTGGGAGGATGG + Intergenic
1073996317 10:109318989-109319011 ATGTGTGTGAGTTGGGGAGAAGG + Intergenic
1074083085 10:110183220-110183242 CAGTGTGTGTGTTGGGGAGAAGG + Intergenic
1074188179 10:111114702-111114724 CTATGGGTGTGATGGGGACAGGG + Intergenic
1074467331 10:113695224-113695246 CTGAGGGTGAACTGGGAAGAGGG - Intronic
1074704415 10:116118466-116118488 CAGTGGTTGAGGTGGGAAGAAGG - Intronic
1074831919 10:117255302-117255324 CTATGAGTTTGTGGGGAAGACGG + Exonic
1074927309 10:118086333-118086355 GTGTGTGTGTGTTGGGAGCAGGG + Intergenic
1074979408 10:118607824-118607846 CTGTGGAGGTTTTGGGGAGAAGG - Intergenic
1075199602 10:120391555-120391577 CTGAGGGTGTCTTGGAATGATGG - Intergenic
1075461155 10:122617367-122617389 CTGTGGGTTGGGTGGGAGGAAGG + Intronic
1075784871 10:125042249-125042271 CTGTGGCTGTCATTGGAAGATGG - Intronic
1076474662 10:130743808-130743830 CTGTTGGTGTCTGGGGAAGCTGG - Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1076709479 10:132324056-132324078 GTGTGGGTGTGTTGGGAGGTGGG - Intronic
1076713069 10:132349720-132349742 CTTTGGGTGGCTTGGGAAGTTGG + Intronic
1076840686 10:133043781-133043803 CAGTGGGTGGGTTGGGGAGGTGG + Intergenic
1077306407 11:1870523-1870545 GTGTGGGGGTGTCAGGAAGAGGG + Intronic
1078085544 11:8231257-8231279 CTGTGTGTATGTTGGGAAGCTGG - Intronic
1078845000 11:15112628-15112650 GTGTGTGTGTATTGGGAAGTGGG + Intronic
1079188880 11:18261281-18261303 CAGTGAATGTGTTGGAAAGAGGG - Intergenic
1080389689 11:31833636-31833658 CTGTGGGTTTGAGGTGAAGAGGG + Intronic
1080445207 11:32331855-32331877 CTGGGGGTGTGGGGGGAATATGG + Intergenic
1080448202 11:32356677-32356699 CTCTGGGTCAGATGGGAAGACGG - Intergenic
1080663923 11:34319221-34319243 CGGTGGGGTTGTGGGGAAGAAGG - Intronic
1080961969 11:37171386-37171408 GTGTGCGTGTGGTTGGAAGAGGG + Intergenic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1082767569 11:57181415-57181437 GGGTGGGTGTTTTGGGAAAAGGG - Intergenic
1083194429 11:61075706-61075728 CGGTGGGAGTGATAGGAAGATGG + Intergenic
1083249261 11:61454795-61454817 CTTTGGGTCCCTTGGGAAGAGGG + Intronic
1083257172 11:61503797-61503819 ATGTGTGTGTGTTGGGGAAAGGG - Intergenic
1083259921 11:61517372-61517394 CTGTGAGTGAGTCGGGCAGAAGG + Intronic
1083325214 11:61869642-61869664 TTCTGGGTGTGTTGGCAAGGGGG - Intergenic
1083610689 11:64002844-64002866 CTTGGGGTGGGGTGGGAAGAGGG - Intronic
1084042489 11:66550359-66550381 CTGTGTGTCTGTTGGGGATAGGG - Intronic
1084207356 11:67603536-67603558 CTGTGGGTGTTTCTCGAAGAGGG + Exonic
1084247344 11:67868146-67868168 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1084480040 11:69414864-69414886 CTGTGGAGCTGTTGGGGAGAAGG + Intergenic
1084726006 11:70942515-70942537 ATGTGGGGGTGTTGGGAGGTGGG - Intronic
1084831157 11:71770383-71770405 ATTTGGGTGTGTTTGGAAGAAGG - Intergenic
1084862113 11:72025884-72025906 TTGTGGGTGGGTAGGGAAAATGG - Intronic
1084932060 11:72563985-72564007 CTGTGTGTGTGATGGTAAGCAGG + Intergenic
1084941167 11:72614154-72614176 GCGTGGGTGTGTGGGGAGGAAGG - Intronic
1084967716 11:72752995-72753017 CTGTGTATGTGCTGGGAGGATGG - Intronic
1085196289 11:74673896-74673918 CTTTGTGTGTGTTGGGTAGGGGG - Intergenic
1085325515 11:75603488-75603510 CAGTGGGTGTGTTAAGCAGAAGG + Intronic
1085391010 11:76182215-76182237 CTGTGTGTGTGTTGGCGCGAGGG - Intergenic
1085413922 11:76307733-76307755 CTGTGTGTGTGTTGGGAGGTGGG - Intergenic
1085448274 11:76615539-76615561 GTGTGTGTGTGTTGGGGGGATGG - Intergenic
1085487312 11:76876243-76876265 CAGTGGTTGTGCTGGAAAGAAGG - Intronic
1085500661 11:77019797-77019819 CTGTGTGTGTGTTGGGGGTATGG + Intronic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085907169 11:80777466-80777488 CTGTGGTTGTAGTGGGAAAATGG - Intergenic
1087242645 11:95797161-95797183 GTGTGTGTGTGTTGGGAGGGGGG - Intronic
1087624373 11:100580243-100580265 TTAAGGGTGTGTAGGGAAGAAGG - Intergenic
1088433739 11:109787563-109787585 CTGGGGGTGGGTGGGCAAGATGG - Intergenic
1088440876 11:109868538-109868560 GTGTGTGTGTGTTGGGATAATGG - Intergenic
1088512559 11:110593391-110593413 GTGTGTATCTGTTGGGAAGAGGG - Intronic
1089318930 11:117611977-117611999 CTGTTTGTGTGTTGGGGGGATGG - Intronic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1090366620 11:126211829-126211851 CGGTGAGTGTGTAGGGAAGCCGG + Exonic
1090452430 11:126818645-126818667 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
1091337443 11:134783029-134783051 CTTGGGGAGTGATGGGAAGAAGG - Intergenic
1091903790 12:4166074-4166096 GTGTGTGTGTGCAGGGAAGAGGG - Intergenic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092203166 12:6599831-6599853 CAGTGGATGTGGTAGGAAGAAGG + Exonic
1092397004 12:8135568-8135590 CTGTCTCTGTATTGGGAAGAGGG - Exonic
1092411535 12:8256882-8256904 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094207178 12:27852972-27852994 TTGTGGGAGTGTGGGGGAGAAGG - Intergenic
1094252834 12:28385797-28385819 CTGTGGATTTGTTGGGACAATGG + Intronic
1094423438 12:30296003-30296025 CTAGGGGTGGCTTGGGAAGAAGG - Intergenic
1094628699 12:32151065-32151087 TGGTGGGGTTGTTGGGAAGATGG + Intronic
1094794434 12:33954469-33954491 TTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095106285 12:38237075-38237097 GTGTGGTGGTGTTGGGAAGTGGG - Intergenic
1095207164 12:39451435-39451457 TGGTGTGTGTGTTGGGAAGTAGG - Intergenic
1095575478 12:43733161-43733183 GTGTGTGTGTGTGGGCAAGATGG - Intronic
1095779488 12:46043770-46043792 CTGTGTGTGTGTTGCGAGGGTGG + Intergenic
1096451593 12:51747121-51747143 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1096496167 12:52040620-52040642 CTGTGGGTATGATGGGAAGCAGG - Intronic
1096655940 12:53092160-53092182 TTGTGGGTGTTTTGAGAATAGGG - Intergenic
1096796844 12:54083028-54083050 TTGTGTGCGTGTTGGGGAGAGGG + Intergenic
1096849932 12:54428907-54428929 ATATGTGTGTGTTGGGAGGAGGG - Intergenic
1096912469 12:54998109-54998131 GTGTGTGTGTGTTGGGATGTTGG - Intergenic
1097081150 12:56432026-56432048 CTGTGGATATGCTGGGCAGAGGG + Intronic
1097330469 12:58327641-58327663 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1097331405 12:58336130-58336152 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1097590884 12:61573835-61573857 ATGTGGATGTTTTGGGGAGATGG + Intergenic
1098205208 12:68101919-68101941 TTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1099016575 12:77350425-77350447 CTGTGTGTGTGTTGAGAGAAAGG + Intergenic
1099411509 12:82334675-82334697 CTGTGTGTGTATGGGGAAGTGGG - Intronic
1099430976 12:82585460-82585482 ATGTGTGTGTGTTGGGTAGAAGG - Intergenic
1100552061 12:95654935-95654957 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100552124 12:95655191-95655213 ATGTGGGGATGTTGGGATGATGG + Intergenic
1100671197 12:96814702-96814724 CTGTTGGTGGGTTGGGGACAAGG - Intronic
1100849706 12:98696473-98696495 CTGTGGCAGTGTTGGGAAGTAGG - Intronic
1101055345 12:100906766-100906788 CTGAAGGTGTTTGGGGAAGAGGG + Intronic
1101332580 12:103769107-103769129 GTGTGTGTGTGTTGGGGGGAAGG - Intergenic
1101616314 12:106341472-106341494 GTGTTGGTGAGTTGGGAAAATGG + Intronic
1101684046 12:106999558-106999580 CTGTGGATTAGTTGGGAAGAAGG - Exonic
1102816529 12:115870470-115870492 CTGTGGGTGGATTTGGTAGAGGG - Intergenic
1103037511 12:117668290-117668312 CCGTGGGTGGGCTGGGAAGGAGG - Intronic
1103966310 12:124642053-124642075 ATGTAGGGGTGTTGGGCAGAAGG + Intergenic
1104545993 12:129713460-129713482 CTTTGTGTGTTTTGGGAAGGAGG + Intronic
1104821025 12:131677734-131677756 CTGAGGCTGTGTAGGGAGGAGGG + Intergenic
1104876880 12:132041045-132041067 CAGTGGGTGTGTGAGGAGGATGG + Intronic
1104996806 12:132663319-132663341 GTGTGGGTGTGTTGTGGGGACGG - Intronic
1105465654 13:20637325-20637347 CTGTGAGTGTTATGGGAAAAGGG + Intronic
1105716977 13:23076500-23076522 CTTTGGGTGAGATGGAAAGAAGG + Intergenic
1105880109 13:24598031-24598053 CTGTGTGTGTGTTGGGAGTTGGG - Intergenic
1106062777 13:26310943-26310965 TTGTGGGTGGGTAGGGAGGAGGG - Intronic
1106295427 13:28409231-28409253 TTTTGAGTGTGGTGGGAAGAGGG - Intronic
1106552108 13:30780974-30780996 CTGTGGCTGTGTTGGGAGTTGGG + Intergenic
1106597157 13:31154868-31154890 TTGTAGTTGTTTTGGGAAGAAGG + Intronic
1106884270 13:34166658-34166680 CTGTGGGTATGTGGAAAAGAAGG + Intergenic
1106885334 13:34178537-34178559 CTGTGGATGTGTTGGGATAGGGG - Intergenic
1107302839 13:38984058-38984080 TTGTGGCTGTGTTGGGGTGATGG - Intronic
1107387347 13:39926282-39926304 GTATGAGTGTGATGGGAAGAGGG + Intergenic
1107461836 13:40611730-40611752 CTGTAGCTGTGATGGGAGGAGGG - Intronic
1107633091 13:42362532-42362554 GTTTGAGTGTGTTGGCAAGAGGG + Intergenic
1109023107 13:57123899-57123921 CTGTGGCTGATTTTGGAAGAAGG + Intergenic
1109290531 13:60469409-60469431 GTGTGTGTGTGTTGGTGAGAAGG - Intronic
1111128579 13:83944345-83944367 CTGTGTGTGTGGTGGGGTGATGG + Intergenic
1111270403 13:85874645-85874667 CTGGGGCTGGGTTGGGAATAGGG - Intergenic
1111415648 13:87940183-87940205 CTGTGGAGGTGTTGGGAGGGCGG + Intergenic
1111735814 13:92138001-92138023 CTGTGTGTGTGTTGGGAGTAGGG + Intronic
1112235508 13:97632562-97632584 TTGGGGGTGGGTTGGGGAGAGGG - Intergenic
1112487737 13:99834998-99835020 CACTGTGTGTGTTAGGAAGAGGG - Intronic
1113452771 13:110423433-110423455 CTGTGGGTGGGTCGGGGGGAGGG + Intronic
1113567105 13:111325692-111325714 CGGTGGGTGTGGAGGGAAAATGG + Intronic
1113682649 13:112255095-112255117 CTGTGGGACTGGTGGGGAGATGG + Intergenic
1113891112 13:113736030-113736052 CTGTTGGGCTGTTGGGAGGAGGG + Exonic
1114236036 14:20824588-20824610 CTGTGAGAGGGTTTGGAAGAAGG + Intergenic
1114990717 14:28284985-28285007 ATGTGGCAGTGTTGGGAAGTAGG - Intergenic
1115400014 14:32946323-32946345 GTGTGTGTGTGTTGGGGGGATGG - Intronic
1115446718 14:33498980-33499002 GTGTGTGTGTGGTGGGAAGGGGG + Intronic
1117166252 14:53036922-53036944 CTGTGGGTGAGGAGGGCAGAAGG - Intronic
1117244515 14:53870884-53870906 GTGTGTGTGTGTTGGAAGGATGG - Intergenic
1117732279 14:58735445-58735467 GTGTGTGTGTGTAGGAAAGAGGG - Intergenic
1118351987 14:64978770-64978792 CTGTGGGTGTTTCTCGAAGAGGG + Intronic
1119188786 14:72664325-72664347 GTGTGTGTGTGTTGGGAGGTCGG - Intronic
1119416905 14:74477029-74477051 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119416917 14:74477108-74477130 GTGTGTGTGTGTTGGGAATGGGG - Intronic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1119717095 14:76867061-76867083 GTGTGGGTGTGTTGGGGGGTGGG + Intronic
1119777994 14:77260073-77260095 TTGTGGGTGTGTTGAGTAGGGGG + Intergenic
1120015707 14:79470986-79471008 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
1120033449 14:79668689-79668711 CTGTTGGTGTGTAAGGAAGGGGG + Intronic
1120835017 14:89031381-89031403 GGGTGGGTGTGTTTGGAAGAGGG - Intergenic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121628877 14:95408304-95408326 GTGTGTGTGTGTTGGGAAAATGG - Intronic
1121711985 14:96045333-96045355 GTGTGGGTGTTTTGGGCAGAGGG + Intronic
1121843393 14:97153017-97153039 GTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1121843681 14:97155246-97155268 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
1122210120 14:100168172-100168194 GTGTGGGTGTGTTGGGGTGGGGG - Intergenic
1122495188 14:102148697-102148719 GTGTGTGTGTGTTTGGAACAGGG + Intronic
1122584238 14:102793597-102793619 ATGTGTCTGTGTTGAGAAGAGGG - Intronic
1122721880 14:103726859-103726881 GAGTGGGGGTGGTGGGAAGAGGG + Intronic
1123761541 15:23437198-23437220 CTGTTGGTGTCTTTGGCAGAAGG + Intergenic
1125440434 15:39696916-39696938 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1125997285 15:44174898-44174920 CTGTTGGGGGGTTGGGAGGAAGG + Intronic
1126792469 15:52233730-52233752 ATATGGGTGTGTTGGGAATGTGG - Intronic
1127289770 15:57559837-57559859 CTCTGGGTCTGTTGGGGGGATGG + Intergenic
1127395316 15:58539912-58539934 CTGTGGGAGTGCTGGGATGAAGG - Intronic
1127577322 15:60304297-60304319 GTGTGTGTGTGTTGGGAAATAGG - Intergenic
1127690363 15:61389617-61389639 CTGTGGGTGGTTTGTGAAGAAGG + Intergenic
1127718958 15:61681108-61681130 CTGTGGGTTTTTTGCAAAGAAGG + Intergenic
1127917397 15:63466601-63466623 CTGTGGAGGTGATGGCAAGAAGG - Intergenic
1128523352 15:68390207-68390229 TTGTGAGTGAGGTGGGAAGAAGG + Intronic
1128650516 15:69409213-69409235 GTGTGTGTGTGTTGGGGAGTTGG - Intergenic
1129126556 15:73446876-73446898 CTCTGGCTGTGGTGTGAAGATGG + Intronic
1129299632 15:74618180-74618202 AAGTGTGAGTGTTGGGAAGAAGG + Intronic
1130902026 15:88214509-88214531 ATGTGGCTGTGTTGGAAATAGGG - Intronic
1130977236 15:88786462-88786484 CTGTGTGTGTGTTGGGGAGAGGG - Intergenic
1131558542 15:93419832-93419854 CTGTGCTTGTTTTGGGGAGAGGG + Intergenic
1131971458 15:97897537-97897559 GTGTGTGAGTGTTGGGAAAAAGG - Intergenic
1132162318 15:99554332-99554354 CTGTGGGTGAGGTGGGGAGTGGG - Intergenic
1132499648 16:279834-279856 CTGTGGGTGGGTGGGGGGGATGG - Intronic
1132800375 16:1749313-1749335 CTGAGGGTGTGTGCAGAAGATGG - Intronic
1132860920 16:2071357-2071379 CTGTGTCTGTGTTGGGATGTGGG + Intronic
1132889032 16:2195359-2195381 CTGTGGGGGTGGAGGGAGGAGGG + Intronic
1133352781 16:5113183-5113205 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1133432950 16:5754570-5754592 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1133483249 16:6192479-6192501 GTATGGGGGTGTTGGGAGGAAGG - Intronic
1133674427 16:8057222-8057244 CTTTTGGTGTTTTAGGAAGAGGG - Intergenic
1133845321 16:9448127-9448149 CTGTGGGTGGGTTGGGGAGATGG + Intergenic
1134138072 16:11693056-11693078 CTGTAAGTTTGTGGGGAAGAGGG - Intronic
1134217978 16:12331058-12331080 CTGTGTCTGTGTTTGGAAGGGGG + Intronic
1134224877 16:12381906-12381928 GTGTGGGTGGGGTGGGTAGATGG - Intronic
1134444474 16:14320458-14320480 CTGTGGGCGCTTAGGGAAGAAGG - Intergenic
1134505146 16:14799360-14799382 TTATGGGTGAGTGGGGAAGAAGG - Intronic
1134507276 16:14818490-14818512 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134540657 16:15062192-15062214 ATGTGGGTATGTTGGTAAGAAGG - Intronic
1134575430 16:15329550-15329572 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134694977 16:16217248-16217270 CAGTGGGAGTTTAGGGAAGATGG - Intronic
1134727015 16:16426942-16426964 TTATGGGTGAGTGGGGAAGAAGG - Intergenic
1134940422 16:18284913-18284935 TTATGGGTGAGTGGGGAAGAAGG + Intergenic
1134976854 16:18577404-18577426 CAGTGGGAGTTTAGGGAAGATGG + Intergenic
1135778225 16:25275817-25275839 CTGTGCATGTGTAGGGAAGGGGG + Intergenic
1137024706 16:35460902-35460924 GTGTGTGTGTGTTGGGGAGAGGG + Intergenic
1137267745 16:46883210-46883232 GTGTGTGTGTGTTGGGATGTGGG + Intergenic
1137731279 16:50692607-50692629 ATGTGTGTGTGTTGGGAAGTGGG + Intergenic
1137731328 16:50692946-50692968 GTGTGTGAGTGTTGGGAAGCAGG + Intergenic
1137731383 16:50693291-50693313 ATGTGTATGTGTTGGGAAGCGGG + Intergenic
1137911014 16:52378538-52378560 GTGTGTGTGTGTTGGCCAGAGGG + Intergenic
1138125567 16:54435705-54435727 AGCTGGGTGTGTTGGGAAGCTGG + Intergenic
1138184261 16:54964131-54964153 CAGTGGGTGTGCTGGGGAGTGGG + Intergenic
1138191279 16:55016182-55016204 GTGGGGGGGTGTTGGGAAAAGGG + Intergenic
1138266442 16:55663244-55663266 GTGTGGGAGTGTTGGGAGGAGGG + Intronic
1138365707 16:56474937-56474959 CTGTGGCTGTGAAGGTAAGAGGG + Exonic
1138565894 16:57832647-57832669 GTGTGTGTGTGTTGGGGAAAGGG - Intronic
1139628300 16:68209828-68209850 CTGTGTGTGTGTTGGGGGGCAGG - Intronic
1140724721 16:77801647-77801669 GTGTGCCTGTGTTGGGAGGAGGG - Intronic
1140733073 16:77873902-77873924 CTGTGGGTGGGAGGTGAAGATGG + Intronic
1140907834 16:79424688-79424710 CTGTGAGACTGTTGGAAAGATGG + Intergenic
1141731209 16:85824503-85824525 CTGTGGGTGTGCTGGGCTGGAGG + Intergenic
1141737189 16:85861503-85861525 CTTTGGGTGAGTTTGGAAAATGG + Intergenic
1142012050 16:87720498-87720520 CTGTGGTTGTGTGGTGAGGAGGG - Intronic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1142327149 16:89423133-89423155 CTCTGAGGGTGTTGGGAAGGTGG - Intronic
1142518367 17:448020-448042 TTGTGTGTGTGTTGGGGGGAGGG + Intergenic
1143476395 17:7205881-7205903 AGGTGGGTGTGCTGGGAAGGAGG - Intronic
1143638541 17:8181510-8181532 CTGTGGGTGAGTGGGAAAAAGGG + Intergenic
1145272555 17:21412606-21412628 CTGAGGCTGTGCTGGGAAGGGGG - Intronic
1146665279 17:34698122-34698144 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
1147306683 17:39569048-39569070 CTGTGGGTGTGGGAGGAGGAAGG - Intergenic
1147357065 17:39906469-39906491 CTGGGGGTGAGCTGGGGAGATGG - Intronic
1148587376 17:48790669-48790691 TTGTAGGTGTGGTGGGAAGAGGG - Intronic
1148819901 17:50354338-50354360 GTGGGGGTGAGATGGGAAGAGGG - Intronic
1148851447 17:50557459-50557481 CTGTAAATGGGTTGGGAAGAAGG + Intergenic
1149637953 17:58185404-58185426 CTGAGGGTGTGCAGGGAGGAGGG - Intergenic
1149650239 17:58272002-58272024 CCTTGGTTGTGTTGGGAAGGTGG - Intronic
1149833742 17:59893639-59893661 GTGAGCGTGTGTTGGGGAGACGG + Intronic
1150091735 17:62332438-62332460 CTGGGGGTGGGCTGGGAGGAAGG + Intergenic
1150857442 17:68766652-68766674 ATGTGGTTGTGTTGGGAGGTGGG - Intergenic
1151128879 17:71875235-71875257 GTGGGGGTGTGATGGGAAGGTGG + Intergenic
1152073336 17:78144844-78144866 GCCTGGGTGTGTTGGGAAGCTGG - Intergenic
1152231778 17:79117522-79117544 GTGTGGGTGTGGAGGGAAGCGGG - Intronic
1152355627 17:79805769-79805791 CTGTGGGTGAGATGGGTAGGGGG + Intergenic
1152449201 17:80365740-80365762 CTGTGTGGGTGTGGGGAAAAGGG - Intronic
1152596933 17:81242375-81242397 CTGTGGGTGGGATGGGAGGCTGG - Intergenic
1152616066 17:81338450-81338472 CTGTGTGTGGGTTGGGGAGGGGG + Intergenic
1153157587 18:2167027-2167049 TTGTTGGTTTGCTGGGAAGAGGG + Intergenic
1153999828 18:10473700-10473722 GAGTGGGTGTCTTGGGAAAATGG + Intronic
1155052170 18:22158045-22158067 CTGTAGGTCTCTTGGGAAGCAGG - Intergenic
1155057126 18:22194712-22194734 ATGTGTGTGTGTTGGGAGGGGGG - Intronic
1155183529 18:23368341-23368363 CTGGGAATGAGTTGGGAAGATGG + Intronic
1156203196 18:34857218-34857240 TCGTGGGTGTGGTGAGAAGATGG - Intronic
1156359466 18:36371731-36371753 GTGTGGTTGTGTTGGAGAGAAGG - Intronic
1156399555 18:36728194-36728216 CTGTTGCTGAGTGGGGAAGAGGG + Intronic
1156622003 18:38864039-38864061 CTGAGGCTGTGCTGGGAAGCAGG - Intergenic
1157418881 18:47528224-47528246 CTGTGGGTGGGTTAGCAGGATGG + Intergenic
1157822567 18:50784453-50784475 GTGTGTGTGTGTTTGGAGGAGGG - Intergenic
1158262425 18:55622893-55622915 GTGTGTGTGTGTTGTGGAGATGG + Intronic
1158315973 18:56211447-56211469 GTGTGTGTGTGTAGGGAGGAAGG - Intergenic
1158323280 18:56287136-56287158 TTGTGGGTGTGTTTCGAAGTCGG - Intergenic
1158804240 18:60950447-60950469 ATGTGGATGTGTTGGGAGGGGGG - Intergenic
1159365750 18:67464172-67464194 CTGGGGGTGTGGTGGAAAGATGG + Intergenic
1160245025 18:77151334-77151356 TGGTGGGTGTGTTGGCAAGGAGG + Intergenic
1160277099 18:77447114-77447136 CTGTGAATGTGTTGGGAATCAGG + Intergenic
1160487551 18:79308225-79308247 CTGTGGGTGGGATTGGAACAGGG + Intronic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1160808213 19:1001657-1001679 CTCTGAGTGGGTTGGGAAGGAGG - Intronic
1161064474 19:2230935-2230957 CTGTGGGTGTGCTGGGGCCAGGG + Exonic
1161393967 19:4035001-4035023 CTGTGTGTGTCTTGGGGAGGAGG + Intronic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1162042709 19:7980179-7980201 CTGTGGGTATCTTGTGAAGGCGG + Intronic
1162830011 19:13278544-13278566 CCGGGGGTGTGGTGGGCAGAGGG - Intronic
1164001230 19:21101311-21101333 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164007994 19:21169514-21169536 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164253284 19:23503658-23503680 CTCTGGGTTTGTAGTGAAGAGGG - Intergenic
1164285258 19:23810012-23810034 CTCTGGGTTTGTGGTGAAGAAGG + Intronic
1164297140 19:23922048-23922070 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164317628 19:24107842-24107864 CTCTGGGTTTGTAGTGAAGAGGG + Intronic
1164686216 19:30168392-30168414 CAGGGGGCGTGTAGGGAAGAGGG - Intergenic
1164958747 19:32408160-32408182 CACGGGGTGTGTTGGGGAGAAGG + Intronic
1165443015 19:35841681-35841703 CTGTGAGGGTGTTGGGGAGGGGG - Intronic
1165867185 19:38946042-38946064 ACCTGGGTGTTTTGGGAAGAAGG + Intronic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166424794 19:42668098-42668120 GTGTGTGTGTGTTGGGAAAAGGG - Intronic
1166653697 19:44594859-44594881 CTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1167097105 19:47380396-47380418 ATGTGGGTGGGGTGGGGAGAAGG + Intronic
1167631362 19:50628154-50628176 CTGTGTGTGTGTTGTGGGGAGGG - Intronic
1167651563 19:50733137-50733159 CTGGGGGTTTTTTGGGGAGAGGG - Intergenic
925060153 2:884761-884783 CAGTGGTGGTGCTGGGAAGATGG + Intergenic
925363219 2:3294271-3294293 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363263 2:3294475-3294497 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925363724 2:3296716-3296738 GTGTGTGTGTGTAGGGAGGATGG - Intronic
925610960 2:5702713-5702735 CTTTCGGTGTGTTGAGAACATGG + Intergenic
925747137 2:7052828-7052850 GTGTGTGTGTGTTGGAAAGGGGG - Intronic
925774311 2:7319123-7319145 CTGTGTGTGTGGTGGGGGGAGGG + Intergenic
926947655 2:18205719-18205741 CTGTGCTTGTGTGGGGAAAAGGG - Intronic
927011770 2:18911634-18911656 GTGTGTGTGTGTTGGTGAGAAGG + Intergenic
927242789 2:20933139-20933161 CTGTATGTATGTTGGGGAGAGGG + Intergenic
927275525 2:21259268-21259290 GTGTGTGTGTGTCGGGAAGGGGG + Intergenic
927735607 2:25518566-25518588 GTGTGTGTGTGTTGGGGTGAGGG - Intronic
927888766 2:26735198-26735220 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
928053661 2:28028374-28028396 GTGTAGGTGTGTTGGGAGGGTGG - Intronic
928349331 2:30534263-30534285 GTGTGTGTGTGTTTGGGAGACGG + Intronic
928355813 2:30613654-30613676 CTGTGGGTGTTTCTCGAAGAGGG + Intronic
928942107 2:36736721-36736743 CTGAGTGTGTGTTGGGGATAGGG - Intronic
929026425 2:37607884-37607906 CTGTGTGTGTGTGGGGAGGCGGG - Intergenic
929439257 2:41952578-41952600 AGAAGGGTGTGTTGGGAAGAGGG - Intronic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
929562067 2:42962216-42962238 CTGTGGGTGCCTTGGGAGGTGGG + Intergenic
929673126 2:43895236-43895258 CTCTTGGTGAGATGGGAAGAGGG - Intronic
930028979 2:47046959-47046981 CCGTGGGTGACTAGGGAAGAAGG - Intronic
930067069 2:47335797-47335819 CTGTTGGTGGGGTGGGAGGAGGG - Intergenic
930370513 2:50495409-50495431 GTGTGTGTGTGTTGGGATGGGGG + Intronic
931239705 2:60441240-60441262 CAGTGAGTGTGCTGGGAAGACGG - Intergenic
931876843 2:66522729-66522751 GCGAGGGTTTGTTGGGAAGAGGG + Intronic
932414598 2:71566001-71566023 GTGTGTGTGTGTTGGGCAGCAGG + Intronic
932469213 2:71942984-71943006 GTGTGTGTGTGGTGGGGAGATGG + Intergenic
932638864 2:73421014-73421036 GTGTGTGTGTGATGGGAAGGTGG - Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
932701330 2:73993979-73994001 CTGTGGGTGTGGTGGGTAGGTGG + Intronic
934930587 2:98419337-98419359 CCTTGGGTGTGGAGGGAAGAGGG - Intergenic
935510070 2:103960652-103960674 GTGTGTGTGTGTTGGGGATAGGG + Intergenic
935903535 2:107818165-107818187 ATGTGGCAGTGTTGGGAAGTGGG + Intergenic
935991032 2:108719329-108719351 CTGAGGGTGTCTTGGCAAGCCGG - Intergenic
936724367 2:115294894-115294916 CTGTGTCTGTGTCGGGAGGAGGG - Intronic
937144812 2:119635499-119635521 CTGTGGATGGGTTGGGTGGATGG + Intronic
937212317 2:120282547-120282569 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
938120153 2:128627325-128627347 ATCTGTGTGTGTTGGGAAGCGGG + Intergenic
939291066 2:140195337-140195359 GTGTGTGTGTCTTGGTAAGAAGG - Intergenic
939704259 2:145432457-145432479 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
940113735 2:150184359-150184381 GTGTGTGTGTGTTGGAGAGATGG - Intergenic
940246840 2:151628276-151628298 GTGTGGGTGTGTTGGATGGAGGG - Intronic
940663977 2:156584110-156584132 CTGTGTGTGTGTCGGGATGGGGG - Exonic
940900159 2:159119342-159119364 AGGTGGGGGAGTTGGGAAGATGG + Intronic
941201704 2:162519478-162519500 CAGTGGGTGGGTTTGGAAGAAGG + Intronic
942189061 2:173453294-173453316 CTGGGGGTGTGATGGGGAAAGGG + Intergenic
942611518 2:177746789-177746811 CTGAGGGTGAGAGGGGAAGAGGG + Intronic
944063340 2:195592525-195592547 GTGTGTGTGTGTTTGTAAGAGGG - Intronic
944297239 2:198080203-198080225 TTGTGTATGTATTGGGAAGATGG - Intronic
944539610 2:200743167-200743189 CTGTGGCTGAGTTGGGAAAGCGG - Intergenic
945624030 2:212177970-212177992 GTGTGTGTGTGTTGGGAAGAGGG + Intronic
946092625 2:217243499-217243521 GTGTGTGTGTGTTGGGGAAAGGG - Intergenic
946160245 2:217831438-217831460 CAGGAGGTGAGTTGGGAAGAGGG - Exonic
946611183 2:221459540-221459562 CTGTGTGTGTGTTGGGAGAAGGG - Intronic
946706555 2:222463965-222463987 CTGTACGTGTGTTGGGGTGAGGG + Intronic
946758964 2:222974279-222974301 CTGTGCGTGTGTTGAAAGGAAGG - Intergenic
946904971 2:224407148-224407170 GTGTGTGTGTGTTGGGAGAAGGG - Intergenic
947020284 2:225666854-225666876 CTGTGTGTGTGTTGGGGGGGTGG - Intergenic
947028733 2:225768718-225768740 CTGTGGGGGAGTTGGGTAGGTGG + Intergenic
947449899 2:230198200-230198222 CTGTGGAAGTGTGTGGAAGAGGG - Intronic
947709818 2:232306560-232306582 CTGTGTTTGTGTTGGGAAGGAGG + Intronic
948043425 2:234923390-234923412 CAGTGGGTGTGCTGGAAAGGTGG + Intergenic
948075939 2:235165266-235165288 CAGTGGGAGTGGTGGAAAGAAGG - Intergenic
948224221 2:236296368-236296390 GGGTGGGTGTGTTGAGAATAGGG - Intergenic
948790075 2:240372455-240372477 ATGTGGGAGGGATGGGAAGAGGG + Intergenic
948825424 2:240571484-240571506 ATGTGGCTGTGGTTGGAAGAGGG + Intronic
1169533405 20:6509780-6509802 TTTTGGGGGTGATGGGAAGAGGG + Intergenic
1170001883 20:11623936-11623958 CTGTGGGTGCTATGAGAAGAGGG + Intergenic
1170476974 20:16725114-16725136 GTGTGTGTGTGTTGGGCAGGAGG + Intergenic
1170557061 20:17523352-17523374 ATGTGGAAGTGTTGGGGAGAGGG + Intronic
1170645238 20:18191740-18191762 CTGGGGGTGAGGTGGGGAGAGGG + Intergenic
1171360662 20:24584417-24584439 CTGTCGGTGTGTTCTGAGGATGG - Intronic
1171426028 20:25049275-25049297 CTCTGTGTGTGTTGGGGAGCTGG + Intronic
1172580133 20:36040877-36040899 CTGTGCATGTGTCGGGAACAGGG + Intergenic
1172946103 20:38690676-38690698 ATGTGTGTGTGTTGGGGGGAGGG + Intergenic
1173215915 20:41083299-41083321 ATGTGGGTATGTTTGGGAGAAGG - Intronic
1173290801 20:41713315-41713337 GTGTGTGTGTCTTGGGAAGAAGG - Intergenic
1173476549 20:43363909-43363931 CTCCGGGTGAGATGGGAAGAAGG - Intergenic
1174457571 20:50660588-50660610 CTGTGGCAGTGTTGGGAGGCGGG - Intronic
1174672858 20:52324144-52324166 CTGTGGGAGGGATGTGAAGACGG + Intergenic
1174882175 20:54292014-54292036 CTGTGGGTTAGGTGGGGAGAGGG - Intergenic
1175169167 20:57067888-57067910 TTCTTGGTGTGTTGGTAAGAGGG - Intergenic
1175315850 20:58046013-58046035 CTCTGGGGTTGTTGTGAAGATGG + Intergenic
1175483089 20:59325487-59325509 CTGTGACTGGGTTGGGGAGATGG - Exonic
1175773982 20:61641578-61641600 CTGTAGGTGTGGTGGGATCAGGG - Intronic
1177867912 21:26535097-26535119 CTGTGGGGGTGTTTGGGGGAAGG + Intronic
1178533272 21:33392672-33392694 CTGGGTGTGTGTTGGGAGGGGGG + Intergenic
1179623284 21:42632732-42632754 CTGTGGGACTGGTGGGAGGAAGG + Intergenic
1179647502 21:42784672-42784694 GTGGGGGTGTGGTGGGATGAGGG - Intergenic
1179947529 21:44688358-44688380 CTGTGGTGGTCTTGGGAAGGTGG - Intronic
1179967709 21:44816958-44816980 CTGGGGGTGTGATGGAAAGGGGG + Intronic
1180594580 22:16964857-16964879 GTGTGGCTGTCATGGGAAGAAGG + Exonic
1180709944 22:17832730-17832752 CTGTGGGTGTGGTGGGGGGAGGG + Intronic
1180900040 22:19364065-19364087 CTATGGGTATGTTGGGGAGGCGG + Intronic
1181273519 22:21674412-21674434 GAATGGTTGTGTTGGGAAGATGG - Intronic
1181320757 22:22004318-22004340 CTGTGGGTGGGTAGGAAAGGGGG - Intergenic
1182073588 22:27479810-27479832 CTGGGGGTGTGGTGGGAGGATGG - Intergenic
1182692867 22:32176017-32176039 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1183486135 22:38088703-38088725 CCGGGGGTGGGTTGAGAAGAAGG - Intronic
1184341768 22:43890074-43890096 CTGTGGGTGTGCAGGGAAGGAGG + Intronic
1184351096 22:43944809-43944831 CTGTGGGTGTGTGGGCCGGACGG + Intronic
1184646401 22:45897612-45897634 CTATGGGGCTGTGGGGAAGATGG + Intergenic
1184707392 22:46224058-46224080 TTGTGGGTGTGGGTGGAAGAGGG - Intronic
949119945 3:373411-373433 CAGTGGGTGTGTTGGGCTGTGGG + Intronic
949676677 3:6462668-6462690 CTGTGTGTGTGTAGGGAACATGG - Intergenic
950123314 3:10496085-10496107 CTGGGGGTGGGATGGGGAGAAGG + Intronic
950833720 3:15900036-15900058 CAGTGGCTGAGGTGGGAAGATGG - Intergenic
952306628 3:32152659-32152681 CTGTGGCAGTGTTGGGAGGTGGG - Intronic
952331464 3:32367736-32367758 CTGTGGGAGGGTGGGGGAGAAGG - Intronic
953341559 3:42138913-42138935 GTGTGTGTGTGTTTGGAGGAGGG + Intronic
953960138 3:47260297-47260319 CTGTGGGTGTTTCTCGAAGAGGG - Intronic
953983358 3:47423904-47423926 CAGTGGGAGAGTTGGGCAGAGGG - Intronic
954428817 3:50458361-50458383 ATGGGGGTGTGTTGGGCACAGGG - Intronic
954523084 3:51247241-51247263 ATGTGGGTTTGTTCAGAAGAAGG + Intronic
954533265 3:51338838-51338860 CCGTGGGTGTGCTGGGCAGGAGG - Intronic
954794417 3:53154288-53154310 GTGTGGGTGGGGTGGGAGGAGGG + Intergenic
955108241 3:55921320-55921342 GTGTTGGTGTTTGGGGAAGAGGG + Intronic
955113371 3:55972424-55972446 CTGTTGGGGTGTTGGGGACAAGG - Intronic
956452403 3:69387237-69387259 CCGTGGCTGAGGTGGGAAGATGG - Intronic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957954101 3:87161384-87161406 CTGTGTGTGTGTAGGGTAGGGGG - Intergenic
958065674 3:88542471-88542493 GTGTGTGTGTGTTGGGATGATGG + Intergenic
959493133 3:107016411-107016433 GTGTGTGTGTGTTTGGCAGAAGG + Intergenic
959956176 3:112240432-112240454 CTGTGAGTGTTTTTGGATGAGGG + Intronic
960027381 3:113024459-113024481 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
960028294 3:113032658-113032680 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
960187767 3:114664594-114664616 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
960259172 3:115546066-115546088 GTGTGAGTGTGTTGGGGGGAAGG - Intergenic
960271324 3:115677530-115677552 CTGTGGATGTGTTGGGGTGAGGG - Intronic
961029230 3:123587501-123587523 CTGTGTGTGTGTTGGGGGGGGGG - Intergenic
961297636 3:125899702-125899724 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
961630769 3:128296821-128296843 CTCTGCGTGTGTTGGCCAGAAGG + Intronic
961869932 3:129979993-129980015 CCGTGTGTGTGTTGGGGAGAAGG - Intergenic
961951822 3:130757506-130757528 GTGTGTGTGTGTCGGGGAGAGGG - Intergenic
962492997 3:135911616-135911638 AAGTGGGTCTGTTGGGAAGCAGG + Intergenic
963078073 3:141366734-141366756 CTGTGGGTGTGTTATCAAGGAGG + Intronic
963080529 3:141389126-141389148 CTATAGGTGTGTTAGGAAGATGG + Intronic
963215021 3:142735782-142735804 GTGTGTGTGTGTTGGGAGGGTGG + Intronic
964411027 3:156398228-156398250 CTGTCGGGGTGGTGGGAAAAGGG + Intronic
965263331 3:166510804-166510826 CAGTGGGTGTGTTGGGCTGTGGG - Intergenic
965519491 3:169658760-169658782 CTCTGGGTGCCTTGGGAACAGGG + Intronic
965941479 3:174187856-174187878 TTGTGGGTTTGTTGGGAGGGTGG + Intronic
966148883 3:176844225-176844247 TTTTGTGTGTGTTGGGAAGTTGG + Intergenic
966839529 3:184077375-184077397 GTGTGGGTGAGGTGGGTAGAAGG + Intergenic
967025810 3:185562730-185562752 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
967026721 3:185570942-185570964 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968041881 3:195595847-195595869 CTGGGGGGGTGTTGGGGAGTGGG - Intergenic
968621205 4:1604203-1604225 GTGTGGATGGGTGGGGAAGAAGG + Intergenic
968999581 4:3969439-3969461 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
969075495 4:4574862-4574884 GTGTGTGTGTGTTGGGAGGAAGG - Intergenic
969526974 4:7708813-7708835 CTGAGGGAGTGGTGGGAGGATGG + Intronic
969575972 4:8036023-8036045 GTGTGGGTGAGTGGTGAAGATGG + Intronic
969677364 4:8621463-8621485 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969678319 4:8627101-8627123 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969679275 4:8632739-8632761 CAGTGGGTGTGTGGGGTGGAAGG + Intergenic
969754427 4:9139195-9139217 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
970270586 4:14342742-14342764 CTGTTGCTGTGTTGGTCAGAAGG - Intergenic
970705273 4:18794128-18794150 GTGTGTGTGTGGTGGGAAGAGGG - Intergenic
970751369 4:19367152-19367174 CTGGGGGTGGGTGTGGAAGAGGG + Intergenic
971132525 4:23828478-23828500 CTGTGGGTTTGGTGTGAGGAGGG + Exonic
971153477 4:24058501-24058523 CTGGGTATGTGGTGGGAAGAGGG - Intergenic
972137670 4:35912223-35912245 GTGTGGCAGTGTTGGGAAGCAGG + Intergenic
972288812 4:37672037-37672059 ATATGGATGTGTTGGGAGGATGG - Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972638093 4:40901933-40901955 GTGTGTGTGTGATGGAAAGATGG + Intronic
972797997 4:42441656-42441678 ATGTGGGTGTGGTGGGATGTGGG - Intronic
973970203 4:56205562-56205584 GTGTGTGTGTGTTGGGGAGAAGG + Intronic
975073229 4:70170119-70170141 GTGTGGGTGTGTGGGGAGGAGGG + Intronic
975172950 4:71253807-71253829 CTGCGTGTGTGTTGGGAAGGAGG + Intronic
975337684 4:73199247-73199269 GTGTGTGTGTGTTGGGAGGAGGG + Intronic
975735193 4:77373732-77373754 CTGTGTGTGTGTTTGGAGGTGGG + Intronic
977005548 4:91565070-91565092 GTGTGTGTGTGATGTGAAGAAGG + Intronic
977411247 4:96668044-96668066 CAGTGGGTGTGTTGGGAAATGGG + Intergenic
978103236 4:104869273-104869295 CTGTGTGTGTGCTGGGAACTGGG + Intergenic
978777682 4:112519349-112519371 CTGCGGGGGTGGGGGGAAGAGGG + Intergenic
978826873 4:113035188-113035210 CTGCAGGTGGGTTGGGAAGGGGG + Intronic
979509618 4:121537523-121537545 ATGTGGTTGTGTTTGGAATAAGG + Intergenic
980078425 4:128318763-128318785 CTGTGCATGTGGTGGGAAAAGGG + Intergenic
980473009 4:133273942-133273964 TTGTGGGTGGGGTGGGGAGAGGG - Intergenic
982091953 4:151887973-151887995 GTGTTGGTGTGTTGGGTGGATGG + Intergenic
982660627 4:158202068-158202090 CTGTGGTTGAGGTGGAAAGAAGG - Intronic
983565733 4:169149654-169149676 TTGTGGGTAAGTTGGGAAGAGGG - Intronic
983794183 4:171839539-171839561 ATGTGTGTGTGTTGGGAATGGGG - Intronic
983949920 4:173627622-173627644 CAGTGGCTGTGTTGTGAAGATGG + Intergenic
983949927 4:173627673-173627695 CAGTGGGTCTGTTGTGAAGGTGG + Intergenic
984299671 4:177899065-177899087 GTGTGTGTGTGTTGGGCCGAGGG - Intronic
984405865 4:179328984-179329006 GTGTGTGTGTGTTGGGATGTGGG - Intergenic
984877981 4:184386323-184386345 CTGAGTCTGTGTTGGGAAGAAGG + Intergenic
985184599 4:187302213-187302235 GTGTGAGAGTGTTGGGAAGGGGG - Intergenic
985273214 4:188214174-188214196 CTGTGGGTTTTCTGGGAAGTGGG - Intergenic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
985815596 5:2125646-2125668 GTGAGGGAGTGTTGGGAGGAGGG + Intergenic
986018012 5:3774989-3775011 GGATGGGTGTGTTGGGTAGATGG - Intergenic
986232998 5:5884033-5884055 CTCTGGATGCATTGGGAAGATGG - Intergenic
986270812 5:6229048-6229070 CTGTGGGACTGTTGGGAAGTTGG + Intergenic
986713957 5:10509141-10509163 ATGTGGTTATGGTGGGAAGAAGG - Exonic
987250185 5:16092577-16092599 CTGTTGGTGGGTGGGGAAAAAGG + Intronic
987628502 5:20435126-20435148 GTGTGTGTGTGGTGGGGAGAGGG - Intronic
989163001 5:38409646-38409668 TAGTGGATGTGATGGGAAGAAGG + Intronic
989467310 5:41772198-41772220 ATGTGGGTTGGTTGGGGAGAAGG + Intronic
989648155 5:43659007-43659029 CTGTGGAAGTGTTGGTCAGATGG + Intronic
990902536 5:60768538-60768560 TTGTGGGTGTGTTGGAATTAAGG - Intronic
990970246 5:61497994-61498016 CTGTGGGGGTCTAGGGATGAGGG + Intronic
992374632 5:76176114-76176136 CTGTGTGTGTGTTGGGGTGGGGG - Intronic
992636272 5:78728593-78728615 CTGGGGGTGAGGTGGGAAGTTGG - Intronic
993808743 5:92446621-92446643 TTGTGAATGTGTTGGGAAGTTGG - Intergenic
994023638 5:95056852-95056874 GTGTGTGTGTATTGGGATGAAGG - Intronic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
994750052 5:103726463-103726485 CTGTGGATTTGTTAGGAAGCAGG - Intergenic
994968445 5:106703877-106703899 CAGTGGTTCTGTGGGGAAGAAGG - Intergenic
995166593 5:109051129-109051151 CTGGGGGTGTATGGGGTAGATGG - Intronic
995785433 5:115822713-115822735 CTGTGGGTGGGTTGGGGGCAAGG - Intergenic
996307160 5:122060404-122060426 GTGTGGGTGTGATGGGAAAGTGG - Intronic
996390174 5:122951790-122951812 CTGTGGGTCTGTTGTGGAGGCGG + Intronic
996408035 5:123125998-123126020 GTGTGGGTGGGTTGGGGGGAGGG + Intronic
997046139 5:130320445-130320467 CTGTGGTTGGGTAGGGGAGAGGG + Intergenic
997130044 5:131267515-131267537 ATGTGTGTCTGTTGGGGAGAGGG + Intronic
997228802 5:132228304-132228326 TTGTGGTGGTGCTGGGAAGAAGG - Intronic
997230068 5:132235819-132235841 CTGTGGGTGAGTGGGGGAGAAGG + Intronic
997652590 5:135533618-135533640 GTGTGTGTGTGTTGGGGGGATGG + Intergenic
997864718 5:137450917-137450939 CTGTGGAGGAGTTTGGAAGAGGG - Intronic
997866009 5:137463525-137463547 GTGGGGGGGTGTTGGGAGGAGGG + Intronic
997982233 5:138475559-138475581 ATGTGGATATGGTGGGAAGAAGG - Intergenic
999181414 5:149672140-149672162 GTGTGTGTGTGTTGGATAGAGGG + Intergenic
999984540 5:156990730-156990752 CTGTCAGAGTGTTGGGAAGTAGG + Intergenic
1000836758 5:166164650-166164672 TTGTGGGGGTGTTTGGAAGGGGG - Intergenic
1001284741 5:170414727-170414749 ATGTGTGTGTGTTTGAAAGAAGG + Intronic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1001450592 5:171821431-171821453 CTGTGGCTATGTTTGGAAGCTGG + Intergenic
1001559981 5:172662787-172662809 CTGTGGGTGGTTAGGGAGGAGGG - Intronic
1001851552 5:174971380-174971402 CTGTGTGGGAGTTGGGCAGAAGG + Intergenic
1002476152 5:179467558-179467580 GTGTGGGCGTGTTGGGAAGGTGG - Intergenic
1002599930 5:180348295-180348317 CTGTGTGTGTTGGGGGAAGAGGG + Intronic
1002688555 5:181034670-181034692 CTGGGGGTGTATTGGGACGCAGG + Intergenic
1002706335 5:181162899-181162921 GTGTGTGTGTGTTTGGAACAGGG + Intergenic
1003005351 6:2376111-2376133 CTGTGTGTGTGTTGGGTGTAGGG - Intergenic
1004300244 6:14451314-14451336 ATGTGTGTGTGTTGAGATGAAGG - Intergenic
1004667356 6:17760916-17760938 CTGTGGGTGGGGTGGGGAGGTGG - Intronic
1005643897 6:27823556-27823578 CTCTTTGTGTGATGGGAAGATGG + Intergenic
1005986880 6:30881227-30881249 CTGGAGGTGTGTTGGGAGGAGGG + Intronic
1006052278 6:31354417-31354439 CTGGGGGTGGGTGGGGCAGAGGG - Intronic
1006504439 6:34479127-34479149 ATGTGGCTGTGTTGGGAGGTAGG - Intronic
1006716316 6:36122980-36123002 CAGTGGGGGTCTTGGGGAGAGGG + Intergenic
1007092861 6:39194814-39194836 CTGTGTGTGTGTTGGAAGCAAGG - Intronic
1007364993 6:41385032-41385054 CTGTGTGTATGTGGGGAAGGGGG - Intergenic
1007592039 6:43027715-43027737 CTGTGTGTGTGTTGGGGGGGGGG - Intronic
1008585710 6:52947133-52947155 GTGTGTGTGTGTTGTAAAGATGG - Intergenic
1009569129 6:65358628-65358650 GTGTGTGTGTGTTGGGAGAAGGG + Intronic
1010551667 6:77231101-77231123 ATGTTTGTGTGTTGGGGAGAGGG + Intergenic
1010986598 6:82432390-82432412 CTCTGGGTTTGATGGTAAGAAGG + Intergenic
1011032679 6:82940675-82940697 CTGAGAGTGGGTAGGGAAGAAGG - Intronic
1011191294 6:84731076-84731098 ATCCAGGTGTGTTGGGAAGAGGG + Intronic
1011536605 6:88382351-88382373 CTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1011557848 6:88588141-88588163 CAGTGGGTGGGTTGGGAAGCGGG - Intergenic
1011614915 6:89189060-89189082 GTGTGTGTGTGTTGGGCAAAGGG + Intronic
1011731070 6:90264352-90264374 TTGTATGTGTGTTGGCAAGAGGG - Intronic
1012505976 6:99946775-99946797 CTAGGGTTGGGTTGGGAAGAAGG + Intronic
1013225512 6:108117600-108117622 ATGTGCGTGTGGTGCGAAGAGGG + Intronic
1013298633 6:108782040-108782062 GTGGGGGTGTGTTGGCAAGGAGG + Intergenic
1013591457 6:111622471-111622493 CTGTGGGTATGGTGGAAAGAAGG + Intergenic
1013609969 6:111785481-111785503 GTTTGTGTGTGTTGGGAAGCGGG - Intronic
1014322382 6:119946082-119946104 GTTTGAGTGTGTTGGGAGGATGG - Intergenic
1014438640 6:121448157-121448179 CTGGGGGTGTATGGGGTAGATGG + Exonic
1015133628 6:129842229-129842251 ATGTGTGTGTTTTGGGTAGAGGG - Intronic
1015169868 6:130240605-130240627 ATGTGACTGTGTTGGGAAGTGGG + Intronic
1015187301 6:130432813-130432835 CTGTAGGATTGTTGTGAAGAGGG - Intronic
1015752942 6:136579235-136579257 CTGTGTGTGTGTTGGGGTGGTGG - Intronic
1015812942 6:137179224-137179246 CTTTGGGTGCGTTCTGAAGAAGG + Intergenic
1016329699 6:142944410-142944432 GTGTGGGTGTGTGGGGGAGGGGG - Intronic
1016782995 6:147980513-147980535 TTGTGTGTGTGTTGGGTAGGAGG - Intergenic
1016982453 6:149864894-149864916 CTGAGGCTGAGTTGGGAGGATGG + Intergenic
1017878598 6:158544207-158544229 GTGTGTGTGTGTTGGGGTGAGGG + Intronic
1018299592 6:162387521-162387543 GTGTGTGTGTGTTGTGAGGAGGG - Intronic
1019158938 6:170056885-170056907 CTGTAGGTGTGGGGGAAAGATGG - Intergenic
1019328365 7:450789-450811 CTGTGGGTGGGTTGGGGGGTGGG - Intergenic
1019723355 7:2586903-2586925 CTGTGGGAGTGTTAGGCAGAGGG + Intronic
1019747974 7:2711149-2711171 CTGAGGCTGTGGAGGGAAGAGGG + Intronic
1019887779 7:3920253-3920275 CTAGGGGTGTTTTAGGAAGATGG + Intronic
1019976082 7:4582608-4582630 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1019977016 7:4591112-4591134 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1019977952 7:4599615-4599637 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1019996152 7:4725621-4725643 GTGTGGCTGTGTTGGGAGGACGG + Intronic
1020050245 7:5076572-5076594 CTGTGGGTGTGTTGGGTTTGGGG - Intergenic
1020375674 7:7482919-7482941 GTGTTTGTGTGGTGGGAAGAAGG + Intronic
1020877674 7:13718511-13718533 GTGTGTGTGTGGTGGGGAGAAGG + Intergenic
1021270416 7:18577963-18577985 ATGTGTGTGTTTTGGGGAGAGGG - Intronic
1021309694 7:19078588-19078610 CTGTGGGTGTGTAGGGAGAGGGG + Intronic
1021342599 7:19482829-19482851 CTGTATGTGTGTTGGCAGGAAGG + Intergenic
1021406880 7:20280427-20280449 TTGTGTGTGTGTTGGGGAGGTGG + Intergenic
1021671642 7:23040619-23040641 CTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1021691766 7:23237100-23237122 GTGTGTGTGTGTTGGGCAGCAGG - Intronic
1022091388 7:27110190-27110212 CTGTGGGTGAGTTGAGCAGGGGG + Exonic
1022109128 7:27217281-27217303 GTGTGTGTGTGTGGGGAAGGTGG + Intergenic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1022752648 7:33246803-33246825 ATGTGTGTGTGTTGGGGTGAGGG + Intronic
1023115548 7:36858488-36858510 ATGTGGGTGTCTTTGGAAGGCGG - Intronic
1023321282 7:39000508-39000530 CTGTGGGTATGTTGAGAAAATGG - Intronic
1023849295 7:44141207-44141229 CTGTGCTTGTGTTGGGTTGAGGG - Intronic
1024392756 7:48834250-48834272 CTGTGTATGTGTTGGGGAGTAGG + Intergenic
1024578921 7:50785988-50786010 CTGTGCGTGTGTGGGGCAGAGGG + Intronic
1026072913 7:67138609-67138631 TAGTGGGGGTGTTGGGAGGAAGG - Intronic
1026703967 7:72673607-72673629 TAGTGGGGGTGTTGGGAGGAAGG + Intronic
1026850029 7:73718618-73718640 CTCTGGGTGTGTCGGGGAGGGGG - Intronic
1027861799 7:83593324-83593346 GTGTGTGTGTGTTGGGGAGGGGG + Intronic
1027906794 7:84195514-84195536 CAGGGGGTTTGTTGGGAGGAGGG - Intronic
1027943586 7:84717081-84717103 ATGTGTGTGTGCTGCGAAGAAGG + Intergenic
1027966093 7:85010508-85010530 CTGTGGGTATGATGAGAAGTAGG + Intronic
1028487926 7:91380283-91380305 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1028720244 7:94022488-94022510 CTGTGAGTGTATTGGGAGCAAGG + Intergenic
1030607430 7:111652574-111652596 GTGTGTGTGTGTTAGGATGAAGG - Intergenic
1031407933 7:121407742-121407764 GTGTGGCTGTGTTGGGAGGTGGG + Intergenic
1031551890 7:123124697-123124719 GTGTGTGTGTGTTGAGAGGATGG + Intronic
1032260190 7:130329595-130329617 ATGTGGTTGTGTTTGGAAGCTGG - Intergenic
1032582556 7:133116867-133116889 CTGTGTGTGTGTGGGGAGGGGGG - Intergenic
1032632559 7:133669419-133669441 CTGTGTGGGTGTGGGGAGGACGG + Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033571199 7:142630443-142630465 GTGTGTGTGTGTTGGGGAGGAGG - Intergenic
1034182813 7:149151415-149151437 TAGTGGGTGAGTTGGAAAGATGG + Intronic
1034288437 7:149907239-149907261 CTGTGGGGGTGTGGAGAAGCAGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034662695 7:152785741-152785763 CTGTGGGGGTGTGGAGAAGCAGG + Intronic
1034725336 7:153330598-153330620 TTGTGTGTGTGTTGGGGAGCTGG + Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035349712 7:158237554-158237576 CTGTGGGTGTTTCTCGAAGAGGG - Intronic
1035591906 8:822712-822734 CTGGTGGTGTGTGGGGAAGCAGG + Intergenic
1036377654 8:8214523-8214545 ATTTGGGGGTGTTTGGAAGAAGG - Intergenic
1036787378 8:11697237-11697259 CTGTGCGTGTGTTTGACAGAAGG - Intronic
1036851909 8:12208626-12208648 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1036873275 8:12451144-12451166 ATTTGGGGGTGTTTGGAAGAAGG + Intergenic
1036968679 8:13329509-13329531 CTGTAGTTGTGATGGGAAGGAGG - Intronic
1036991834 8:13607079-13607101 CTGTCGGTGGGTGGGGAACAAGG - Intergenic
1037458107 8:19083547-19083569 GTCTAGGTGTGTTGGGGAGATGG + Intronic
1037498485 8:19463342-19463364 CTGTGGGTATGGTGGGTGGATGG - Intronic
1037693991 8:21207899-21207921 CTGTGGGGGTGGGGGGTAGAGGG - Intergenic
1037916018 8:22773890-22773912 CGATGGGAGAGTTGGGAAGAAGG + Intronic
1037935923 8:22915065-22915087 CTGTGGGGATATTGGGGAGAGGG - Intronic
1038419709 8:27425517-27425539 CTGTGCATGTGTGGGGAAGGGGG - Intronic
1039143464 8:34419355-34419377 ATGTGTGTGTGTAGGGGAGAGGG + Intergenic
1039606306 8:38883685-38883707 ATGTGGGTGAGTTGGTGAGAAGG + Intergenic
1039622563 8:39011972-39011994 ATGTGGGGGAGTTGGGGAGAAGG + Intronic
1040534809 8:48299537-48299559 GTGTGTGTGTGTTGGGGAGGCGG - Intergenic
1041263174 8:56039153-56039175 GAGTGAGTGTGTTGGGCAGAGGG + Intergenic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041374496 8:57199785-57199807 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1041618316 8:59934358-59934380 CTGTGGATATCTGGGGAAGAGGG + Intergenic
1041627873 8:60051814-60051836 CTGTGAGTGGGGTGGGAAGTGGG - Intergenic
1042743361 8:72075896-72075918 GTGTGTGTGTGTTGGGTGGAGGG + Intronic
1043428361 8:80171180-80171202 GTGTGCGTGTGTGGGGGAGAGGG - Intronic
1043826006 8:84929306-84929328 CAGTGGGTGTGTTGGGCTGTAGG - Intergenic
1044752834 8:95432484-95432506 CTGTGTGTGTGTTCAGAATATGG + Intergenic
1045194028 8:99911850-99911872 ATGTGGCTGTGTTGGGAGGTGGG - Intergenic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046227812 8:111307968-111307990 GTGTGGCAGTGTTGGGAAGTGGG - Intergenic
1046838865 8:118835169-118835191 GTGTGTGTGTGTTGGGAGGGAGG + Intergenic
1046890357 8:119415853-119415875 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1047882586 8:129212692-129212714 GGATGTGTGTGTTGGGAAGAGGG + Intergenic
1048463539 8:134642720-134642742 CTGTGCGAGTGCTGGGAAGCTGG - Intronic
1048570783 8:135653987-135654009 CTGTGGGTGTGTGGGGGTAAAGG - Intronic
1048867835 8:138773703-138773725 CTGTGGGTGCTGAGGGAAGACGG + Intronic
1048933117 8:139332297-139332319 GTGTGTGTGTGTTGGGCAGGGGG - Intergenic
1049297764 8:141852270-141852292 CTGTGGGGGTGGTGGGAGCAAGG + Intergenic
1050233559 9:3554816-3554838 GTGTGTGTGTGTTGGAAAGTTGG - Intergenic
1050615959 9:7402054-7402076 GTGTGTGTGTGTTGGGAAAGGGG - Intergenic
1051442174 9:17097064-17097086 CTGTGAGTGTGTAGGGCAGGAGG - Intergenic
1051844541 9:21436776-21436798 CAGTTGGTGTGTTTGCAAGATGG + Intronic
1052331684 9:27276549-27276571 CTGTGGGTGGGGTGGGGAAACGG + Intergenic
1052554857 9:30000605-30000627 GTGTGTGTGTGTTGGGGCGAGGG + Intergenic
1053056640 9:34996885-34996907 GTGTGTGTGTGCTGGGGAGATGG + Intronic
1053158559 9:35797172-35797194 TTAGGGGTGTGTTGGGGAGAGGG + Intronic
1053786417 9:41655656-41655678 TTGCGTGTGTGTTGGGGAGAGGG + Intergenic
1054322188 9:63681791-63681813 CTGTGGGTGTTTCTCGAAGAGGG + Intergenic
1054450104 9:65398842-65398864 TTGCGTGTGTGTTGGGGAGAGGG + Intergenic
1054903228 9:70391205-70391227 CTCTCGCTGTGTTAGGAAGATGG + Intronic
1054923219 9:70562602-70562624 TTGTGTGTGTGTTGGGCAGGGGG + Intronic
1055521380 9:77084370-77084392 GTGTGTGTGTGTTATGAAGAGGG + Intergenic
1056198659 9:84253279-84253301 ATGAGGCTGTGTAGGGAAGAGGG - Intergenic
1056255513 9:84795340-84795362 CCCTGGGCGTGTTGGGATGAGGG - Intronic
1056911783 9:90707713-90707735 GGGTGGATGTGTGGGGAAGATGG - Intergenic
1057270543 9:93648170-93648192 CTGTTGGTTTGTTGGAGAGAAGG + Intronic
1057312223 9:93949642-93949664 CTGTGGGTCAGTGGGGAAGTTGG - Intergenic
1057538889 9:95945796-95945818 ATATAGTTGTGTTGGGAAGATGG + Intronic
1057869888 9:98709280-98709302 GTGTGCGTGTGCTGGGAAGGTGG - Intergenic
1058637913 9:107054805-107054827 CTGATGAAGTGTTGGGAAGAGGG - Intergenic
1058984359 9:110197586-110197608 TTGAGGGTCTCTTGGGAAGATGG - Intronic
1059059023 9:111015394-111015416 CAGTGGGTTTGGAGGGAAGAAGG - Intronic
1059706740 9:116830964-116830986 CTGTGGGTGGGTGGGGAGAAGGG - Intronic
1060017333 9:120098154-120098176 CAGAGGGTGGGGTGGGAAGATGG + Intergenic
1060258231 9:122051543-122051565 CTGTGGGTGTGTTGGGTTTTGGG - Intronic
1061418195 9:130459430-130459452 GTGTGTGTGTGTGGGGGAGAGGG + Intronic
1061554303 9:131357474-131357496 CTGTGGGTGTTTCTCGAAGAGGG - Intergenic
1061872897 9:133530098-133530120 CTGTGTGTGTGCTGGGAGGACGG + Intergenic
1062118997 9:134824019-134824041 GTGTGTGTGTGTTGGGATGGGGG + Intronic
1203655961 Un_KI270752v1:25056-25078 GTGTGTGTGTGTTGGGGGGAGGG - Intergenic
1185815466 X:3151154-3151176 GTGTTTGTGTGTTGGGGAGATGG + Intergenic
1186502190 X:10060412-10060434 TTGTGTGTGTGTTGGGGAGGGGG + Intronic
1187038478 X:15567280-15567302 GTGTGTGTGTGTTGGGCAGGGGG - Intronic
1187760778 X:22581539-22581561 CTGTGGGTGGGTTGGGGGCAAGG + Intergenic
1188456203 X:30369364-30369386 CTGAGTGTGTGTTGTGAGGAGGG - Intergenic
1189132493 X:38514747-38514769 GTGTGTGTGTGTTGGGGAGGTGG - Intronic
1190623338 X:52311114-52311136 CTGATGATGTGTTTGGAAGAAGG + Intergenic
1191780807 X:64863200-64863222 CTGTGGGGGAGGTGGGGAGAGGG - Intergenic
1192679941 X:73241950-73241972 CTGTGATGGTGATGGGAAGAGGG + Intergenic
1193424821 X:81328817-81328839 GTGTGGCAGTGTTGGGAGGAGGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1194406309 X:93500134-93500156 TTGGGGGTGTGGTGGGAGGAGGG + Intergenic
1194504733 X:94719631-94719653 TTGAGGGAGTGCTGGGAAGAGGG - Intergenic
1195288143 X:103405209-103405231 CTGTGGTTGTTATGGGACGATGG + Intergenic
1195600019 X:106735900-106735922 GTGTGTGTGTGTTGGGGGGAGGG - Intronic
1196164933 X:112528451-112528473 GTGTGTGTGTGTTGGGATAAGGG - Intergenic
1196298211 X:114023588-114023610 CTGTGTGTGTGTTGGTAGGGGGG + Intergenic
1197163069 X:123345429-123345451 GTGTGTGTGTGTTGTGAAGGGGG - Intronic
1197175009 X:123476364-123476386 GTGTGTGTGTGTTGGGGAGAGGG + Intronic
1197367175 X:125578568-125578590 CTGTGGAGGTGTTGGGAGGTGGG - Intergenic
1197503647 X:127274492-127274514 GTGTGTGTGTGTTTGGAGGAGGG + Intergenic
1197614978 X:128680853-128680875 CTGTGTGTGTGTTTGGGGGATGG - Intergenic
1197896938 X:131326378-131326400 GTGTGTGTGTGTTTGGGAGAGGG + Intronic
1198654149 X:138895280-138895302 GTATGTGTGTGTTGGGAGGAAGG + Intronic
1199077034 X:143536117-143536139 CTGTGGGTGTCAGGGGAAGGGGG - Intergenic
1199833904 X:151569747-151569769 CTGAGGGTGGGGTGGGGAGAGGG + Intronic
1200755682 Y:6987904-6987926 CTGTGTGTGTGTTGGGGTGGAGG + Intronic
1200831314 Y:7690460-7690482 CTGTGGGTCTTTTGGGGAGCGGG + Intergenic
1201584823 Y:15548863-15548885 CTTTGGCTGTGTTGGGAAGAGGG + Intergenic