ID: 1076691266

View in Genome Browser
Species Human (GRCh38)
Location 10:132224875-132224897
Sequence GGCCACGGCGAGGCCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076691266_1076691274 19 Left 1076691266 10:132224875-132224897 CCAGGACTGGCCTCGCCGTGGCC 0: 1
1: 0
2: 2
3: 12
4: 301
Right 1076691274 10:132224917-132224939 GCCCCAAAAGAAACTTTTTGTGG No data
1076691266_1076691272 -3 Left 1076691266 10:132224875-132224897 CCAGGACTGGCCTCGCCGTGGCC 0: 1
1: 0
2: 2
3: 12
4: 301
Right 1076691272 10:132224895-132224917 GCCACAAGGGTAAGAGCACAGGG No data
1076691266_1076691271 -4 Left 1076691266 10:132224875-132224897 CCAGGACTGGCCTCGCCGTGGCC 0: 1
1: 0
2: 2
3: 12
4: 301
Right 1076691271 10:132224894-132224916 GGCCACAAGGGTAAGAGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076691266 Original CRISPR GGCCACGGCGAGGCCAGTCC TGG (reversed) Intronic
900013723 1:135656-135678 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900014269 1:137758-137780 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900043793 1:491639-491661 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900044132 1:492960-492982 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900065230 1:726642-726664 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
900065541 1:727866-727888 GGCCACCGTGAGGCCTGACCTGG + Intergenic
900162336 1:1230005-1230027 GTCCGAGGCGTGGCCAGTCCTGG + Intronic
900674838 1:3878695-3878717 GGTCACAGCGAGGCCGGCCCGGG - Intronic
901025208 1:6275440-6275462 GGCCACAGCTAGGCCAGGCGCGG + Intronic
901455291 1:9359768-9359790 GGCCTCTGAGAGGCCAGGCCAGG + Intronic
901880655 1:12191902-12191924 GGCTTCGGCGTGGCCAGACCAGG + Exonic
902049898 1:13554950-13554972 GGCCCCGCCGAGGCCTGACCGGG - Intergenic
902410778 1:16210319-16210341 GCCCACAGCGAGGCCAGGCTAGG - Intronic
902796953 1:18806274-18806296 GGCCACAGGAAGGCCAGCCCTGG - Intergenic
903177123 1:21587834-21587856 GACCATAGCGAGGCCATTCCAGG - Intergenic
903177567 1:21590089-21590111 GGCCACGGCGGGGCCAGGCCAGG - Intergenic
904684132 1:32248513-32248535 GGCCAGGGCTAGGCCGGCCCCGG - Exonic
905505577 1:38476561-38476583 GGCCGGGGGGAGGCCAGGCCCGG - Intergenic
908901886 1:68965018-68965040 GGCCACCTGGAAGCCAGTCCTGG + Intergenic
911316746 1:96365161-96365183 GGCAAAGGGGAGGCCAGCCCTGG - Intergenic
913957411 1:143318501-143318523 GGCCAGGGCAAGGCAAGACCAGG + Intergenic
913957884 1:143320580-143320602 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
914051725 1:144143865-144143887 GGCCAGGGCAAGGCAAGACCAGG + Intergenic
914052193 1:144145938-144145960 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
914127004 1:144820603-144820625 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
914127472 1:144822676-144822698 GGCCAGGGCAAGGCAAGACCAGG - Intergenic
914937594 1:151993994-151994016 GGCCTCTGCGAGGCGGGTCCGGG - Exonic
915355051 1:155250855-155250877 GGGCAGGGCTAGGCCAGGCCAGG - Intronic
922100326 1:222473415-222473437 GGCCACCGTGAGGCCTGACCTGG + Intergenic
922562294 1:226578043-226578065 GCCCACGGGGAGGGCAGTCTGGG - Intronic
922734325 1:227971324-227971346 GGCCACCGTGAGGCCTGACCTGG - Intergenic
922734899 1:227973598-227973620 GGCCACCGTGAGGCCTGACCTGG - Intergenic
923008181 1:230068012-230068034 GCCCCGAGCGAGGCCAGTCCCGG + Intronic
923671776 1:236047554-236047576 GCCCACGGAGAGGCCAACCCTGG + Intronic
924343592 1:243055348-243055370 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1063971286 10:11382858-11382880 GGCCCCGGGGAGGACACTCCTGG - Intergenic
1066681347 10:37939015-37939037 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
1066732529 10:38448771-38448793 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1066759795 10:38740020-38740042 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1066961831 10:42232748-42232770 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1074360850 10:112823242-112823264 GGCCTCTCCTAGGCCAGTCCTGG - Intergenic
1074574887 10:114659295-114659317 GGCCACTTCGAGACCAGCCCTGG + Intronic
1075016946 10:118916851-118916873 AGCCACGGCATGCCCAGTCCAGG + Intergenic
1075552557 10:123402765-123402787 GGCCACACAGAGGTCAGTCCAGG + Intergenic
1076374175 10:129972637-129972659 GTTCACTGCGAGGCCAGGCCTGG + Intergenic
1076680281 10:132168171-132168193 AGCCAAGGCCAGGCCCGTCCCGG - Exonic
1076691266 10:132224875-132224897 GGCCACGGCGAGGCCAGTCCTGG - Intronic
1076970067 11:127870-127892 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1076970466 11:129435-129457 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1076982117 11:210136-210158 GGCCAAGGAGATGCCAGTTCTGG + Intronic
1077309453 11:1881927-1881949 GGCAGCTGCGAGGCCAGGCCGGG + Intronic
1077337863 11:2013506-2013528 GCCCATGGAGAGACCAGTCCTGG - Intergenic
1078053470 11:7987388-7987410 GGCCACGCCAACCCCAGTCCCGG + Exonic
1078091225 11:8265911-8265933 GGCCACAGCTAGCCCAGTCCTGG - Intronic
1078507798 11:11965439-11965461 GGCCACGGGGAGGCCAGGAGTGG - Intronic
1079163137 11:18012866-18012888 GGCCGCGGCGTGGGCAGTTCAGG - Intronic
1079239684 11:18713830-18713852 GGTCAGGGCAGGGCCAGTCCGGG - Exonic
1081765309 11:45606314-45606336 GGCCACGACCAGGGCAGTTCAGG + Intergenic
1081969033 11:47185931-47185953 GCCCACGGCAAGGCCGGCCCAGG - Intronic
1081993048 11:47347816-47347838 GGCCTGGGGGAGGCCAGTGCTGG - Intronic
1083140678 11:60718697-60718719 GGGCAGGGCCAGGCCAGCCCAGG - Intergenic
1083292425 11:61697321-61697343 GGCCAGGGCGAGGGAAGGCCTGG + Intronic
1083599589 11:63938740-63938762 GGCAACGGCGGCGCCAGGCCTGG - Intergenic
1084964605 11:72738126-72738148 GGCCAGGTGGAGGCCATTCCAGG + Intronic
1089556262 11:119317255-119317277 GGCCCCGGCGCCGCCAGCCCGGG + Intronic
1089681607 11:120121867-120121889 GGCCAGGGCGAGGCCAGGTAGGG + Intronic
1090618591 11:128540846-128540868 GGCCACGGAGAGGCCAGACCAGG + Intronic
1202820847 11_KI270721v1_random:68688-68710 GCCCATGGAGAGACCAGTCCTGG - Intergenic
1096622883 12:52875333-52875355 GGCCAGGTGGAGGCCACTCCTGG - Intergenic
1100818329 12:98407264-98407286 GTCCACGGAGAGGCCACTCCTGG + Intergenic
1101144713 12:101830497-101830519 GGGCACGGCGAGGGCAGTGCAGG + Intronic
1104655573 12:130571828-130571850 GGCCACAGGGAGGCCAGTGTGGG - Intronic
1105780755 13:23703382-23703404 ACCCACGGTGAGGCCAGCCCAGG + Intergenic
1112632778 13:101180493-101180515 GGCCACGCGGAGGCCAGGCGTGG - Intronic
1113709112 13:112452503-112452525 GGCCACTGAGAGGCCATGCCTGG + Intergenic
1113863120 13:113502976-113502998 TGCCAAGGCGAGCCCTGTCCTGG - Intronic
1115310484 14:31974101-31974123 TGGCAGGGCCAGGCCAGTCCAGG - Intergenic
1116307942 14:43282565-43282587 GGCCATGGCCAGGTCAGTCTTGG + Intergenic
1117773150 14:59155046-59155068 GGCCAAGGCAAGGCTAGGCCTGG + Intergenic
1117972894 14:61269890-61269912 GGCCACGGCGAGGTGACTTCAGG + Intronic
1118327103 14:64788677-64788699 GGCTACAGTGAGGCCACTCCAGG - Intronic
1119754631 14:77106865-77106887 GCCCAGGGCCAGGACAGTCCAGG + Intronic
1122178513 14:99938073-99938095 GGCCACGGCCAGGCAAGCCCAGG - Intronic
1122968988 14:105144830-105144852 GGCTCTGGCGAGGCTAGTCCTGG - Intronic
1123443228 15:20304719-20304741 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1128245159 15:66127891-66127913 TGCCACGGGGCTGCCAGTCCTGG + Intronic
1132599988 16:769059-769081 GGCCCCGGCTAGGACATTCCCGG + Intergenic
1132667478 16:1088856-1088878 GGCCACGGCGACGTCTGTGCGGG + Intergenic
1132988949 16:2783316-2783338 GGTCACGGCTGGGCCAGGCCAGG - Intergenic
1133024099 16:2980247-2980269 GGCCACGCCGAGGCCCCTCACGG + Intronic
1135382702 16:22008032-22008054 GGCGTTGGCGAGGCCGGTCCCGG - Intronic
1135521723 16:23182994-23183016 GGCCACGGCGTGGGTAGACCCGG - Intronic
1136718638 16:32303157-32303179 GGCCAGGGAAAGGCCAGTGCAGG + Intergenic
1136723012 16:32339240-32339262 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1136773947 16:32861183-32861205 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1136837010 16:33509421-33509443 GGCCAGGGAAAGGCCAGTGCAGG + Intergenic
1136841332 16:33545239-33545261 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1136862989 16:33713767-33713789 GGCCATGGCAAGGCCAGGCCAGG - Intergenic
1136896662 16:34000336-34000358 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1137578625 16:49620524-49620546 GGCCAGAGCCAGGCCTGTCCCGG - Intronic
1137717944 16:50610455-50610477 GGCCACCGCGTGGCCAGGTCTGG + Intronic
1141407128 16:83804454-83804476 GGCCAGGGCTAGGGCAGCCCAGG + Intergenic
1141708217 16:85681528-85681550 GGGCATGGCGAGTCCAGTCTTGG + Intronic
1142136264 16:88453286-88453308 GGCCACTGCGAGGGCGCTCCTGG - Intergenic
1142138321 16:88461460-88461482 GGTCACAGCAAGGCCAGGCCAGG - Intronic
1142449783 16:90168047-90168069 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1142450610 16:90171262-90171284 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1203003419 16_KI270728v1_random:178524-178546 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1203007793 16_KI270728v1_random:214614-214636 GGCCAGGGAAAGGCCAGTGCAGG - Intergenic
1203076367 16_KI270728v1_random:1123294-1123316 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1203124469 16_KI270728v1_random:1561915-1561937 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1203135027 16_KI270728v1_random:1714931-1714953 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1203147188 16_KI270728v1_random:1809700-1809722 GGCCAGGGAAAGGCCAGTGCAGG + Intergenic
1203151497 16_KI270728v1_random:1845536-1845558 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1142456952 17:62429-62451 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1142457303 17:63799-63821 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1143001740 17:3799018-3799040 GGGCCAGGCCAGGCCAGTCCTGG + Intronic
1143007458 17:3846160-3846182 GGCCCCGGCGGGGCCGGCCCTGG - Exonic
1143670552 17:8393090-8393112 GGCCACCTCCAGGCCAGGCCAGG - Exonic
1146485011 17:33235671-33235693 GGCCAAGGCTGGGCCTGTCCAGG - Intronic
1151572849 17:74935912-74935934 GCCCACGGCGATGCCTCTCCCGG + Intronic
1151956555 17:77383009-77383031 GGCCACAGCAAGGCCAGGCTGGG + Intronic
1152931952 17:83114470-83114492 GGCCACCGCGCGGCCAGCACGGG + Intergenic
1154414860 18:14171287-14171309 GGCCAGGGCAAGGGCAGGCCAGG + Intergenic
1154415006 18:14171783-14171805 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1157411825 18:47469495-47469517 GGCCTGGGCCAGGCCAGGCCAGG + Intergenic
1160225594 18:77008701-77008723 GGCCCCGGGATGGCCAGTCCAGG - Intronic
1160646865 19:197788-197810 GGCCACCGCGAGGCCTGAGCTGG + Intergenic
1160647662 19:200904-200926 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1160830903 19:1104504-1104526 GGCCACGGCGGGGCGTCTCCGGG + Intronic
1160859372 19:1231151-1231173 GGCCACGGCGTCGCCCGCCCGGG + Exonic
1161194475 19:2978363-2978385 GGCCTGGGCGGGGCCAGCCCAGG - Intronic
1161251402 19:3282313-3282335 GGTCATGGGGAGGCCAGTTCTGG - Intronic
1161968399 19:7561597-7561619 GGCCACCCCCAGCCCAGTCCAGG - Exonic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1163370721 19:16899800-16899822 GGCCACGGAGAAGCCTGACCTGG - Intronic
1163443764 19:17334665-17334687 GGCCATGGCGAGGACAGGTCAGG + Exonic
1163928420 19:20366426-20366448 GGCCACTGTCATGCCAGTCCAGG + Intergenic
1164620723 19:29694706-29694728 GGTCCCGGCCAGGCCAGGCCAGG - Intergenic
1164992190 19:32692415-32692437 CTCCAGGGCGAGGCCAGGCCCGG - Exonic
1165263068 19:34637194-34637216 TGCCAGGGCGAGGCCAAGCCTGG + Intronic
1165386362 19:35512720-35512742 GGCCAGGGCCAGGGCAATCCTGG - Exonic
1167358715 19:49018821-49018843 GGCCACGGCGGGGGCTGTGCAGG + Intergenic
1167569317 19:50276932-50276954 GGCCACGGGGAGGGCAGGGCAGG + Intronic
1168009848 19:53521379-53521401 GGCCACGGCGGGGCCCCACCAGG - Exonic
1168307247 19:55442375-55442397 GGCCAGGGCCCGGCCAGGCCGGG - Exonic
1202691121 1_KI270712v1_random:96289-96311 GGCCAGGGCAAGGCAAGACCAGG + Intergenic
1202691592 1_KI270712v1_random:98362-98384 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
930071513 2:47369753-47369775 GGAAACGGCGAGGGCCGTCCCGG + Intronic
930798703 2:55420064-55420086 GGCGGCGGCGAGGCTAGCCCGGG - Intergenic
932690987 2:73913567-73913589 GGTCACGGCCAGCCAAGTCCAGG - Exonic
933954798 2:87355588-87355610 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
933955272 2:87357662-87357684 GGCCAGGGCAAGGCAAGACCAGG - Intergenic
934238993 2:90251814-90251836 GGCCACGGCAGGGCCAGCCCAGG - Intergenic
934239460 2:90253875-90253897 GGCCAGGGCAAGGCAAGACCAGG - Intergenic
934273725 2:91562823-91562845 GGCCAGGGCAAGGCAAGACCAGG + Intergenic
934274199 2:91564896-91564918 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
934323113 2:91984365-91984387 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
934461428 2:94215156-94215178 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
943081176 2:183260811-183260833 GACCACGGCGCGGGCAGTCACGG - Intergenic
945241540 2:207681404-207681426 GGGCGCGGCCAGGCCAGGCCCGG + Intergenic
946153915 2:217794498-217794520 GGCCACAGGGAGGCCAGAGCGGG - Intergenic
1168894311 20:1313126-1313148 GCCCACGGAGAGGCCAGTGGAGG + Intronic
1170945474 20:20887628-20887650 GGGGACAGCGAGGCCAGACCAGG + Intergenic
1171215599 20:23350275-23350297 GGCCACGGCGAGGGCAACGCCGG - Intergenic
1172445435 20:34990834-34990856 GGCCCCAGCCAGGCCAGCCCTGG - Intronic
1175108322 20:56629620-56629642 CGCCCCGCCGAGGACAGTCCGGG + Intronic
1175947406 20:62565333-62565355 GGACAGGGCGGGGCCAGCCCAGG - Intronic
1176112733 20:63417924-63417946 GGCCGCGCCGAGGCCAGGGCAGG - Intronic
1176858164 21:13986984-13987006 GGCCAGGGCAAGGGCAGGCCAGG - Intergenic
1176866136 21:14056181-14056203 GGCCATGGCAGGGCCAGCCCTGG + Intergenic
1179154663 21:38839282-38839304 GGCCCCAGCCAGGCCCGTCCAGG - Intergenic
1179209537 21:39313542-39313564 GGCCGCGCCGAGGCCTGACCGGG + Exonic
1179857757 21:44171021-44171043 GGCTACGGCCGGGCCAGGCCAGG - Intergenic
1180549861 22:16530242-16530264 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1181276424 22:21689937-21689959 GGCCACGGCGAAGCCACGACAGG - Intronic
1181354816 22:22291600-22291622 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1181573046 22:23778216-23778238 GGGCATGGCAAGGCCAGGCCAGG - Intronic
1183506218 22:38210373-38210395 GGCCAAGGTGGGGACAGTCCAGG - Intronic
1183510098 22:38229690-38229712 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510143 22:38229918-38229940 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510166 22:38230032-38230054 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183510189 22:38230146-38230168 GACCACAGGGAGGCCAGCCCAGG + Intronic
1183706640 22:39478534-39478556 GGCCAGGGTGAGGCCAGCCAAGG + Intronic
1184199872 22:42961045-42961067 GGCCAGGGCAGGGCCAGTTCAGG + Intronic
1184593967 22:45503183-45503205 GGCCTCGGCGCTGACAGTCCGGG - Intronic
1184974578 22:48051976-48051998 CGCCCCGGCCAGGCCAGCCCAGG + Intergenic
1185038178 22:48490276-48490298 GGCCGCGGCGAGCCCCCTCCGGG - Intronic
1185101051 22:48841016-48841038 GACCACGGGGAGGCCAGGGCAGG - Intronic
950684634 3:14607671-14607693 GGTAATGGGGAGGCCAGTCCCGG - Intergenic
952287276 3:31981161-31981183 GACCATGGAGAGGGCAGTCCAGG - Exonic
952419361 3:33117627-33117649 GGCCACAGCCAGGCAAGGCCTGG - Intronic
953019949 3:39107056-39107078 AGCCACGCCGAGGACAGTCCCGG - Intronic
954371335 3:50170972-50170994 GGCCCAGGGGAAGCCAGTCCTGG - Intronic
959063607 3:101636592-101636614 GGCCACTGCCCTGCCAGTCCAGG + Intergenic
961359411 3:126357540-126357562 GGCCAGGGCGGGGCCAGGGCGGG - Intergenic
965714409 3:171587286-171587308 GGCCCAGGCCAGGGCAGTCCAGG - Intergenic
968081078 3:195847443-195847465 GACCACGGCCAAGCCTGTCCTGG + Intergenic
968370185 3:198219211-198219233 GGCCACCGTGAGGCCTGACCTGG - Intergenic
968370816 3:198221734-198221756 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
968448679 4:665057-665079 GGCCACCTCGGGGCCAGGCCAGG + Intronic
968904656 4:3445712-3445734 GACCCCGGCGGGGCCAGCCCGGG + Intronic
968917672 4:3503948-3503970 CCCCAGGGCGTGGCCAGTCCAGG + Intergenic
969103264 4:4785831-4785853 GGCCACGTGGAGCCCAGGCCCGG - Intergenic
969293489 4:6255383-6255405 GGCCTCGGAGAGCCCACTCCTGG + Intergenic
969609150 4:8217270-8217292 GGCCATGGCCAGGTCTGTCCGGG - Intronic
979328863 4:119406338-119406360 GGCCACCGTGAGGCCTGACCTGG + Intergenic
980913683 4:139015658-139015680 GGCCACTGCGCGGCCACGCCAGG - Intergenic
980923961 4:139115516-139115538 GGGCGCGGCCAGGCCAGGCCCGG - Intronic
981762113 4:148206026-148206048 GGCAATGGTGAAGCCAGTCCAGG + Intronic
989282862 5:39665271-39665293 TGGCAGGGCCAGGCCAGTCCAGG + Intergenic
992111578 5:73498843-73498865 GGCTAGGCCGAGGCCAGGCCAGG + Intronic
993048387 5:82895277-82895299 CTCCACGATGAGGCCAGTCCTGG + Intergenic
993319943 5:86459471-86459493 GGCCACAGCCAGGTCAGTCTTGG - Intergenic
997248202 5:132369637-132369659 GGCCCGGGCGGGGCCTGTCCTGG - Intergenic
1002316596 5:178348158-178348180 GGCCAAGGCAAGGCCAGTCGGGG - Intronic
1002729711 5:181325969-181325991 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1002730050 5:181327290-181327312 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1003585963 6:7389649-7389671 CGGCACGGCGAGGCCCGTGCTGG - Exonic
1006787518 6:36678599-36678621 GGCCCCGGGGAGGGCGGTCCCGG + Intronic
1007693579 6:43718044-43718066 TGCTACGGCCAGGCCAGGCCAGG - Intergenic
1007737006 6:43988017-43988039 GGACAGGGCAAGGCCATTCCCGG - Intergenic
1018613198 6:165662640-165662662 GGCCACGGCCAGGCCACTCGGGG + Intronic
1018730485 6:166646461-166646483 GGCCACGGAGGAGCCAGTCGAGG + Intronic
1018936074 6:168274759-168274781 GGCCACGCAGAGGCCATTGCAGG - Intergenic
1019150628 6:170003262-170003284 GGGGTCGGCCAGGCCAGTCCTGG - Intergenic
1019168771 6:170117001-170117023 GGCCCAGGAGAGGCCAGTCCTGG + Intergenic
1019179673 6:170178383-170178405 GGCCACGGGCAGGGCAGCCCAGG + Intergenic
1020016565 7:4835071-4835093 GGCCGCGGGGAGGCTGGTCCTGG - Exonic
1020139246 7:5603728-5603750 GGACAGTGCGGGGCCAGTCCGGG - Intronic
1020660346 7:10974116-10974138 GGCCAGGGCCAGGCGAGGCCGGG + Exonic
1022097954 7:27152467-27152489 AGCCCCGGCCAGGCCAGGCCTGG - Intronic
1023400937 7:39792753-39792775 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074388 7:45811222-45811244 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024074721 7:45812580-45812602 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024075210 7:45814494-45814516 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1024648695 7:51388024-51388046 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052242 7:55741301-55741323 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025052640 7:55742849-55742871 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025053024 7:55744306-55744328 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025129199 7:56366984-56367006 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025129923 7:56369856-56369878 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130222 7:56371085-56371107 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130542 7:56372383-56372405 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025130860 7:56373677-56373699 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025131179 7:56374972-56374994 GGCCACCGTGAGGCCTGACCTGG + Intergenic
1025177883 7:56811096-56811118 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025178462 7:56813430-56813452 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025178892 7:56815172-56815194 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025179328 7:56816962-56816984 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025179786 7:56818848-56818870 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025180235 7:56820686-56820708 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025180706 7:56822668-56822690 GGCCACGGCGAGGCAAGAGGTGG + Intergenic
1025181581 7:56826257-56826279 GGCCACGGCGAGGCAAGAGGTGG + Intronic
1025690336 7:63750723-63750745 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025690785 7:63752546-63752568 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025691225 7:63754321-63754343 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025691666 7:63756145-63756167 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025692110 7:63757968-63757990 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025692558 7:63759791-63759813 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025692973 7:63761470-63761492 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1025693418 7:63763293-63763315 GGCCACGGCGAGGCAAGAGGTGG - Intergenic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1032051430 7:128653090-128653112 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1032051841 7:128654694-128654716 GGCCAAGGCCAGGCCCGTGCAGG - Intergenic
1032165309 7:129540429-129540451 GTTCACGGAGAGGCCAGGCCTGG + Intergenic
1033462247 7:141557461-141557483 GGCCATGGCTAGGTCAGTCGGGG + Intronic
1036676606 8:10839434-10839456 GGCGGCGGCGGGGCCAGTCCCGG + Intronic
1037992310 8:23329773-23329795 GGCCACGGCGAGGCAGGCCTGGG + Intronic
1037999780 8:23381778-23381800 GGGGACGGCGAGGCCATGCCAGG + Intronic
1039445235 8:37625879-37625901 GCCCACAGGCAGGCCAGTCCTGG + Intergenic
1039542239 8:38381999-38382021 GGCCACGGCCGGGCCGGGCCGGG + Exonic
1040108839 8:43556743-43556765 GGCCACTGCCTTGCCAGTCCAGG - Intergenic
1040299711 8:46181525-46181547 GGCCACAGTGTGGCTAGTCCGGG - Intergenic
1040325901 8:46341362-46341384 GGCCACAGTGAGGCCAGATCGGG + Intergenic
1041673763 8:60517422-60517444 GGCCGCGGCCTGGCCAGGCCCGG + Intronic
1044545193 8:93451409-93451431 GGCCACAGCTAGGCTAGACCTGG + Intergenic
1044934164 8:97277526-97277548 GGCCGCGGCCAGGCCCGGCCCGG - Exonic
1046186895 8:110734011-110734033 AGCCAAGGCTACGCCAGTCCCGG + Intergenic
1049355251 8:142184498-142184520 GGCCTTGGCAAGTCCAGTCCTGG - Intergenic
1053691291 9:40588657-40588679 GGCCAAGGCAAGGCCAGGGCAGG - Intergenic
1053691902 9:40590788-40590810 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1054272901 9:63046703-63046725 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1054273074 9:63047298-63047320 GGCCAGGGCAGGGCCAGTTCAGG + Intergenic
1054273511 9:63048828-63048850 GGCCAAGGCAAGGCCAGGGCAGG + Intergenic
1054302551 9:63389628-63389650 GGCCAAGGCAAGGCCAGGGCAGG - Intergenic
1054303159 9:63391754-63391776 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1054401323 9:64716128-64716150 GGCCAAGGCAAGGCCAGGGCAGG - Intergenic
1054401765 9:64717669-64717691 GGCCAGGGCAGGGCCAGTTCAGG - Intergenic
1054401938 9:64718264-64718286 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1054434931 9:65200448-65200470 GGCCAAGGCAAGGCCAGGGCAGG - Intergenic
1054435544 9:65202579-65202601 GGCCATGGCAGGGCCAGCCCAGG - Intergenic
1054494849 9:65819108-65819130 GGCCATGGCAGGGCCAGCCCAGG + Intergenic
1054495022 9:65819703-65819725 GGCCAGGGCAGGGCCAGTTCAGG + Intergenic
1054495458 9:65821233-65821255 GGCCAAGGCAAGGCCAGGGCAGG + Intergenic
1054722111 9:68614642-68614664 GGCCACCTCCAGCCCAGTCCTGG + Intergenic
1060547665 9:124470494-124470516 GGCCACGGTGAAGCCCGTGCTGG + Exonic
1061500503 9:130998788-130998810 GGCCACGGGGACACCAGGCCGGG + Intergenic
1061697962 9:132392101-132392123 GGCCACGGAGAGGCTACTTCGGG + Exonic
1061767078 9:132888231-132888253 TGCCACGGCATGGCAAGTCCCGG + Intronic
1061838954 9:133346869-133346891 GGCAAAGGCGGGGCCAGTCCTGG - Intronic
1061866093 9:133492467-133492489 GGCCAGGCCGAGACCCGTCCTGG + Intergenic
1062041989 9:134408452-134408474 GGGCTCCGCGAGGCCATTCCAGG + Intronic
1062597607 9:137306214-137306236 GGCCCCGACTGGGCCAGTCCAGG + Intergenic
1062754125 9:138278481-138278503 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1062754465 9:138279804-138279826 GGCCACCGCGAGGCCTGAGCTGG - Intergenic
1203577683 Un_KI270745v1:21238-21260 GGCCACCGTGAGGCCTGACCTGG - Intergenic
1186801949 X:13101928-13101950 GGACAAGGCGAGGCTAGGCCTGG + Intergenic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1190952631 X:55161534-55161556 GGCCACGGCCTGGTCAGCCCCGG - Intronic
1192195914 X:69028076-69028098 AGCCAAGTCCAGGCCAGTCCAGG - Intergenic
1199720421 X:150539542-150539564 GGTCATGGAGAGGCCAGACCAGG + Intergenic
1200084800 X:153598919-153598941 GGCCGCGGCGCCGCCTGTCCTGG + Intronic
1201160345 Y:11160441-11160463 GGCCACGGGGAGGTCAGGACCGG - Intergenic
1201282853 Y:12356334-12356356 GGCCACAGCAAGCCTAGTCCAGG - Intergenic
1202583058 Y:26402527-26402549 GGCCATGGCAGGGCCAGCCCAGG + Intergenic