ID: 1076692311

View in Genome Browser
Species Human (GRCh38)
Location 10:132230131-132230153
Sequence CGAGGCCGCCTTGGGAGGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076692304_1076692311 5 Left 1076692304 10:132230103-132230125 CCGAGAACAGACGGAGACTAAGC No data
Right 1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG No data
1076692303_1076692311 6 Left 1076692303 10:132230102-132230124 CCCGAGAACAGACGGAGACTAAG 0: 1
1: 0
2: 0
3: 18
4: 160
Right 1076692311 10:132230131-132230153 CGAGGCCGCCTTGGGAGGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076692311 Original CRISPR CGAGGCCGCCTTGGGAGGGC GGG Intronic
No off target data available for this crispr