ID: 1076692836

View in Genome Browser
Species Human (GRCh38)
Location 10:132232522-132232544
Sequence TGCCCTCAGCCCCCCAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 624}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076692836_1076692841 7 Left 1076692836 10:132232522-132232544 CCAGGCCTGGGGGGCTGAGGGCA 0: 1
1: 0
2: 4
3: 81
4: 624
Right 1076692841 10:132232552-132232574 CCGACTCAAACGCTTCCTCCAGG No data
1076692836_1076692842 14 Left 1076692836 10:132232522-132232544 CCAGGCCTGGGGGGCTGAGGGCA 0: 1
1: 0
2: 4
3: 81
4: 624
Right 1076692842 10:132232559-132232581 AAACGCTTCCTCCAGGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076692836 Original CRISPR TGCCCTCAGCCCCCCAGGCC TGG (reversed) Intronic
900117342 1:1034248-1034270 TGCCCACAGCCTCCCCGGGCTGG - Intronic
900142423 1:1144282-1144304 TGCCCTGGGCCACCCAGCCCGGG - Intergenic
900159416 1:1216403-1216425 TGCCCTGAGCCCACCTGCCCAGG - Intergenic
900212574 1:1463309-1463331 TGCCTTCTGCCCCACAGACCTGG - Intronic
900244408 1:1630798-1630820 CGCCTCCCGCCCCCCAGGCCCGG + Intergenic
900404612 1:2487014-2487036 TGCCCTCAGCCCAGCTGTCCTGG + Intronic
900420756 1:2555018-2555040 GGCCCTCAGCGCCCCCTGCCAGG - Intergenic
900648373 1:3719102-3719124 TGACCTGAGCCACCCCGGCCGGG + Intronic
900719568 1:4166625-4166647 TGTCCTCTGCCCCCCTGGCCTGG + Intergenic
900736080 1:4300319-4300341 TGCCCTAGTCACCCCAGGCCAGG - Intergenic
901038204 1:6349046-6349068 TGTCCTCAGCACCCAAGGGCTGG + Intronic
901054354 1:6441854-6441876 TGCCCTCCCCCCCCCAGCACAGG + Intronic
901216101 1:7556198-7556220 TGCCCTAGTCACCCCAGGCCAGG - Intronic
901325791 1:8364404-8364426 TGCCCTGCTCCCCCAAGGCCAGG + Intronic
901653240 1:10755088-10755110 TGCTCTCTGCCCTTCAGGCCTGG - Intronic
901763919 1:11488114-11488136 TGCTCCCAGCCCCAAAGGCCAGG - Intronic
902336235 1:15756520-15756542 TGCCCTCCGCCCTCCCTGCCAGG - Intergenic
902595847 1:17508955-17508977 TGCCCTCCTCCCCCCAGTCATGG + Intergenic
902605925 1:17569371-17569393 GGCCCTCAGCCACACAGCCCAGG - Intronic
902768050 1:18630094-18630116 CCTCCTCAGGCCCCCAGGCCGGG - Intergenic
902930221 1:19725905-19725927 ACTCCTCAGCCCCCAAGGCCTGG - Intronic
903548250 1:24140688-24140710 TTCCCTCAGGCCCCCAGGCTTGG + Intronic
903557484 1:24204225-24204247 AGCCTTCCGCCTCCCAGGCCAGG - Intergenic
903753530 1:25645125-25645147 CGCCCTCAGCACACCAGGCGAGG - Intronic
903931587 1:26865246-26865268 TTCCCGCCGCCCGCCAGGCCTGG + Intergenic
904039511 1:27575848-27575870 GGCCCCCGGCCCGCCAGGCCGGG + Intronic
904160712 1:28520266-28520288 TGCCCTCCGTCCCCCACACCAGG - Intronic
904470000 1:30730281-30730303 TGCCCTCACCTGCCCAGGCCTGG + Intergenic
904556558 1:31368671-31368693 TTGCCTCAGCCTTCCAGGCCAGG - Intronic
904768301 1:32867378-32867400 TCCCCTGAGCTTCCCAGGCCTGG + Intronic
905418289 1:37820032-37820054 TTCACTCAGCACCCCAGGACAGG + Intronic
905465128 1:38147422-38147444 TGCCTTCAGCCAGCAAGGCCAGG + Intergenic
905926348 1:41752504-41752526 TTCCCTCAGCCCCCTAGGCTGGG - Intronic
906202967 1:43971687-43971709 TGCCCTTAGCCGTCCAGCCCGGG - Exonic
906241513 1:44245081-44245103 TGACCTCTGACCCCCAGGGCTGG + Intronic
908567376 1:65371019-65371041 GGTCCTCTGGCCCCCAGGCCAGG - Intronic
909413366 1:75378894-75378916 TGCCCCCAGCACCACAGGGCAGG + Intronic
910179342 1:84464070-84464092 TCCACTCAGCTCCACAGGCCAGG + Intergenic
911468449 1:98284921-98284943 CTCCCCCAGCCCCCCAGCCCCGG + Intergenic
912682798 1:111739597-111739619 TGCCCTCCGCCGCGCTGGCCGGG - Intronic
914928615 1:151909777-151909799 GCCCCTCAGCCCCTCAGCCCCGG + Exonic
915402522 1:155634015-155634037 TGCCCCCAGCACCACAGGGCAGG - Intergenic
915460234 1:156066113-156066135 ACCCAGCAGCCCCCCAGGCCCGG - Intronic
915735342 1:158081028-158081050 GCCCCCCAGCTCCCCAGGCCAGG + Intronic
916009574 1:160692585-160692607 TGCCCCCAGCACCACAGGGCAGG + Intronic
916213523 1:162377115-162377137 TACCCCCAGCCCTCCAGCCCTGG + Intronic
919183380 1:194114475-194114497 TGCCCTCAGCTCGCCAAGCATGG - Intergenic
920048689 1:203150358-203150380 AGCCAGCAGCCACCCAGGCCAGG - Intronic
920293385 1:204940015-204940037 GGCCCTCAGCTCCCCAGGCTGGG - Intronic
920529591 1:206692340-206692362 GACCCTCAGCCCCTCAGACCAGG + Intronic
920539257 1:206765821-206765843 TGGCCTAAGCCTTCCAGGCCAGG + Intergenic
920964526 1:210690918-210690940 TGCCCTCACCCTCCCACCCCAGG - Intronic
921367112 1:214384108-214384130 TGCCACCAGCACCCCAGACCTGG - Exonic
922370518 1:224906438-224906460 TTCCCTCAGACCCCAAGGCAAGG + Intronic
922732094 1:227954009-227954031 TGGGCTCAGCCTCCCAGGCCTGG - Intergenic
923220843 1:231891619-231891641 TGCCCTAATCACCCCAGACCAGG - Intronic
923769720 1:236927834-236927856 TGCCCTCAGTGCCCCTGCCCTGG - Intergenic
924934199 1:248754812-248754834 GCCCCTCACCCCTCCAGGCCCGG + Intronic
924957717 1:248945164-248945186 TGCCCTCAGCCCGCCCGCCCAGG - Intergenic
1063179360 10:3583999-3584021 TCTCCTGAGCCCCCCAGGCCAGG + Intergenic
1063449928 10:6144683-6144705 GGCCCGCAGCCCCCCAGACGCGG - Intergenic
1065093045 10:22253248-22253270 TGCCCTCAGCCCCGCAGCGTAGG + Intergenic
1065133009 10:22641736-22641758 TGCCATGAGCCCCCCATGCCCGG + Intronic
1066087303 10:31983442-31983464 TGATCTCAACCGCCCAGGCCTGG - Intergenic
1067063473 10:43090035-43090057 TGCCATCAGCCCCTCACTCCGGG - Intronic
1067478798 10:46582488-46582510 TCCCCTGAGCCCCATAGGCCAGG - Intronic
1067615941 10:47759313-47759335 TCCCCTGAGCCCCATAGGCCAGG + Intergenic
1067732274 10:48820780-48820802 TGCTCTCTGCCTCCCAGGGCCGG + Intronic
1069577184 10:69539115-69539137 GGCCTTCAAGCCCCCAGGCCTGG - Intergenic
1069642316 10:69963852-69963874 TGTCCTCAGCACCCCTGCCCTGG - Intronic
1069779316 10:70944840-70944862 TGCCCTCAGCCTTGCAGCCCTGG + Intergenic
1069867318 10:71511843-71511865 TGCCATCAGCCACCCAGGAGAGG - Intronic
1070554788 10:77519148-77519170 TGGCTTCAGCCCGCCTGGCCTGG + Intronic
1070693293 10:78543319-78543341 TGCCCCCAACCCCGCAGCCCTGG - Intergenic
1070702290 10:78612908-78612930 TGCCCTCACCACTCCATGCCAGG + Intergenic
1070713753 10:78702567-78702589 CGCCCTCACCCCCGCAGGCCAGG + Intergenic
1070887915 10:79921106-79921128 GTCCTTCAGCTCCCCAGGCCCGG - Intergenic
1070931472 10:80264059-80264081 TGCCCTCTGACCTCCAGGCGTGG - Intergenic
1071531348 10:86392261-86392283 TGCTATCAGCAACCCAGGCCTGG - Intergenic
1071757514 10:88560447-88560469 TACCCTGAGCCCCACAGCCCAGG + Intronic
1072692025 10:97578205-97578227 GCCCATCAACCCCCCAGGCCGGG - Intronic
1072735737 10:97878145-97878167 AGCCCACTGCTCCCCAGGCCAGG - Intronic
1072947917 10:99827096-99827118 TGCCCCCAGCACCACAGGGCAGG - Intronic
1073116363 10:101094046-101094068 TGCCCTCTCCCACCCTGGCCAGG + Intronic
1073207202 10:101775624-101775646 TGCCCTCAGCCCTCCCGCGCCGG + Intronic
1073328901 10:102658336-102658358 TCCCCTATCCCCCCCAGGCCTGG + Exonic
1073442417 10:103560251-103560273 TCCTTCCAGCCCCCCAGGCCAGG - Intronic
1073773533 10:106761443-106761465 TGCCCACATCCCCTCAGGGCAGG - Intronic
1074382542 10:112992333-112992355 TCGCCTCCGCCCCCCAGCCCTGG + Intronic
1075032046 10:119030073-119030095 CGGCCCCAGCGCCCCAGGCCCGG - Exonic
1075253358 10:120903005-120903027 TGCACTCAGCACACCTGGCCTGG - Intronic
1075903965 10:126064738-126064760 TGCCCCCAGTCCCACAGCCCAGG + Intronic
1076487977 10:130836373-130836395 TGGCCACAGCTCCCCAGTCCAGG - Intergenic
1076497124 10:130904607-130904629 TGACCCCACCCCTCCAGGCCAGG + Intergenic
1076692836 10:132232522-132232544 TGCCCTCAGCCCCCCAGGCCTGG - Intronic
1076782121 10:132730217-132730239 TTCCCTCAGCCCCTCTGCCCTGG + Intronic
1076858850 10:133130185-133130207 TGCTCTCAGCCCTGCAGGGCTGG - Exonic
1076915179 10:133419846-133419868 TGCCCGGAGCCTCCAAGGCCAGG - Intronic
1076963564 10:133786678-133786700 TGCCCTCAGCCCGCCCGCCCGGG - Intergenic
1077047432 11:552674-552696 TCCCTCCAGCCCCCCAAGCCTGG + Exonic
1077147771 11:1053588-1053610 TCCTCTCAGCCACGCAGGCCTGG - Intergenic
1077194072 11:1270574-1270596 TGCACTTGGCCCACCAGGCCGGG - Intergenic
1077235417 11:1479832-1479854 TGCTTTCAGCAACCCAGGCCTGG + Intronic
1077253760 11:1571824-1571846 CGCCCTCCGCCCCCCGGCCCGGG + Intronic
1077365821 11:2161194-2161216 AGCCCTCAGCCCTCCAGGACAGG - Exonic
1077402129 11:2364144-2364166 TGCCCTCTGCCCCACTCGCCTGG - Intergenic
1077414360 11:2417949-2417971 TGCCCACCGCCCACCGGGCCCGG + Intronic
1077437448 11:2549702-2549724 GGCCCTGGGCTCCCCAGGCCTGG + Intronic
1077514193 11:2992026-2992048 TCCCGCCAGCGCCCCAGGCCCGG + Intronic
1077900156 11:6481249-6481271 TCCCCTCAGGGCGCCAGGCCCGG + Exonic
1078546300 11:12249492-12249514 TGCCCTCCTACCCCCAGCCCTGG + Intronic
1079035272 11:17014668-17014690 TCCCCTTTGCCCCCGAGGCCGGG + Intergenic
1079428211 11:20363816-20363838 CGCGCTCAGCGCCGCAGGCCCGG - Exonic
1080792623 11:35535443-35535465 TGTCATCAGCCACCCAGGCCTGG + Intergenic
1081612708 11:44572594-44572616 TGTCCGCAGCCGCCCAGGCTGGG + Intronic
1081705576 11:45180658-45180680 CGCCCCCCGCCCGCCAGGCCCGG - Intronic
1081770203 11:45645688-45645710 CGCCCTCCGCTCCTCAGGCCTGG - Intergenic
1081774292 11:45666730-45666752 TGCTCTCTGCGCCCCAGTCCAGG - Intergenic
1081802498 11:45869658-45869680 TGCCCTCAGCCCACTTGGCCAGG - Exonic
1082091612 11:48094936-48094958 AGCCCTCACCCCCTCAGGGCTGG - Intronic
1083780117 11:64913425-64913447 TGCCCTGGCCACCCCAGGCCTGG + Intronic
1083955066 11:65978471-65978493 TTCCCACTGCACCCCAGGCCTGG + Intronic
1084189216 11:67491428-67491450 TGCCCCCAGACACCGAGGCCAGG - Intergenic
1084432131 11:69116956-69116978 TGCCCTGGGCAGCCCAGGCCTGG - Intergenic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1084493096 11:69488841-69488863 TGGCCTCACCCTCCCAAGCCTGG - Intergenic
1084524476 11:69687066-69687088 TGCCTTGAGCCTCCCATGCCTGG + Intergenic
1084667536 11:70584513-70584535 TGCCCCCATCACCCCAGGGCTGG + Intronic
1085035415 11:73297052-73297074 TGACCTCAGCCCGCCTGCCCTGG + Exonic
1085260320 11:75200716-75200738 TGCCCTCACCTCCAGAGGCCAGG - Intronic
1085454354 11:76657287-76657309 AGCCCTCAGCCTCTCAGCCCTGG + Intergenic
1085509837 11:77082647-77082669 GGCCCTCAGCCAGCCAGGCCTGG + Intronic
1085742969 11:79092567-79092589 TGCTCACAGCCAGCCAGGCCTGG + Intronic
1085788875 11:79478595-79478617 TGCTGTCAGCTCTCCAGGCCAGG + Intergenic
1087558643 11:99754921-99754943 TCCCCTCTGCCCCCAAGCCCTGG + Intronic
1087723907 11:101696871-101696893 TGCCCCCAGCACCACAGGGCAGG + Intronic
1087880990 11:103416148-103416170 CTCCCTCAGCCCCCCAGCCTGGG - Intronic
1089374614 11:117985887-117985909 TGTCCTCAGACCCCCAGACGGGG + Intergenic
1089468833 11:118704779-118704801 TGTCCTCAGCTCCTCATGCCAGG - Intergenic
1089471931 11:118728344-118728366 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1089621473 11:119725153-119725175 GACCCTCTGCCCCCCAAGCCTGG + Intronic
1089750704 11:120649193-120649215 TGCCCTCTGCCCCACACACCTGG + Intronic
1089757175 11:120695599-120695621 TACCCACTGCCTCCCAGGCCTGG + Intronic
1089760797 11:120721655-120721677 TGCCCTAATCACCCCGGGCCAGG - Intronic
1089770267 11:120797358-120797380 TGCACTGCGTCCCCCAGGCCTGG - Intronic
1089784476 11:120898353-120898375 TTCCCTCAGCCCCCCAACCCTGG + Intronic
1090402366 11:126456960-126456982 CGGCCTCAGCTTCCCAGGCCGGG + Intronic
1091114429 11:132999941-132999963 TGCACTCAGCCCACCAGACCTGG + Intronic
1091264804 11:134262239-134262261 TGCCCACAGCCACCCTGGCTGGG - Intronic
1091318466 11:134632658-134632680 TGAGCTCAGCAGCCCAGGCCTGG - Intergenic
1091754664 12:3043646-3043668 TTCCCCCAGACCCCCAGGGCTGG - Intergenic
1091799457 12:3315711-3315733 TGCTCCCAGCCCCCCGGGTCAGG - Intergenic
1091847674 12:3669826-3669848 TGTCCCCAGCCTCCCAGGCTGGG - Intronic
1092241499 12:6838983-6839005 TGCCCTCATCCCTCCAGGCTCGG + Exonic
1094753498 12:33439807-33439829 TCCCCTCAGCACTCCATGCCGGG - Exonic
1095944373 12:47745757-47745779 TGACTGCAGCCCCACAGGCCAGG + Intronic
1096183860 12:49565900-49565922 TGCCCTCAGTCCCACAGGGAAGG + Intronic
1096469367 12:51866341-51866363 AGGCCTCAGCCCCTCTGGCCTGG + Intergenic
1096477296 12:51916019-51916041 AGGCCTCACCCCCACAGGCCTGG + Exonic
1097331274 12:58335085-58335107 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1100274468 12:93059149-93059171 TGCCCTCTGCCCCTCTGGGCTGG - Intergenic
1101773788 12:107775608-107775630 CGCCCTCGAGCCCCCAGGCCTGG - Exonic
1102993368 12:117330514-117330536 GGCCCCCAGGCCCCCAGGCCAGG - Exonic
1103359096 12:120342973-120342995 TGCCCCCAACTCCCCGGGCCCGG - Exonic
1103528020 12:121580352-121580374 CGCCCCCACCCCCCCAAGCCCGG - Intronic
1103723766 12:122987922-122987944 TGCCCTCCGACCCCCTGACCTGG - Intronic
1103764467 12:123271102-123271124 TGCCCGCAGCGCCCCCCGCCCGG + Intronic
1103905945 12:124327199-124327221 TACCCTCTGCCCCCCAGCCCCGG - Intronic
1103918839 12:124389200-124389222 AGCCCACAGACCCCCGGGCCGGG + Intronic
1104003876 12:124878669-124878691 TGCCCTCAGTGCACCAGGACTGG + Intronic
1104157888 12:126151070-126151092 GGCCCTCAGCCGACCAGGCGCGG + Intergenic
1104320676 12:127748004-127748026 TGCCCACAGCCCTCTAGGCAGGG - Intergenic
1104375821 12:128265528-128265550 TGCCCCCTGCCCCCAAGGTCAGG + Intergenic
1104620477 12:130308150-130308172 TTCCTCCTGCCCCCCAGGCCTGG + Intergenic
1104647865 12:130509718-130509740 TGCCCTCTGCCCCCCCGCCCCGG + Intronic
1104700016 12:130895844-130895866 TGCCCTCAGCCTTCGAGGCCAGG - Intergenic
1104735604 12:131134212-131134234 GGGCCTGAGCCCCCTAGGCCAGG + Intronic
1104798486 12:131536767-131536789 TGCCCTCTGCTCCCCCGGCAAGG + Intergenic
1104854965 12:131897198-131897220 TGCCCTCGCCCCCACAGGCGTGG + Intronic
1105455667 13:20538981-20539003 TTCCCTCATTCCCCCAGTCCTGG + Intergenic
1107407888 13:40131934-40131956 TCCCCTCAACCTCCCAGTCCTGG + Intergenic
1108691320 13:52861813-52861835 GGCCCTCTTCCACCCAGGCCTGG + Intergenic
1109758920 13:66800226-66800248 TGCCCTCTCACCCCCAGCCCGGG + Intronic
1110630300 13:77698571-77698593 TGCCCGAAGCCCCCGAGGCCAGG - Intronic
1110691562 13:78435481-78435503 TGATCTCATCCCCACAGGCCTGG + Intergenic
1112021206 13:95372706-95372728 TGCGCTGAGCTGCCCAGGCCTGG + Intergenic
1112595643 13:100804704-100804726 TGCCCTCATCACCCAGGGCCAGG + Intergenic
1113493913 13:110713560-110713582 AGCCCGCAGCCCCCAGGGCCTGG + Intronic
1113607489 13:111620736-111620758 TTCCCACAGCCCCCCAGGAGAGG - Intronic
1113737613 13:112689854-112689876 TGCCCTCTGCCCCCAGGGTCTGG + Intergenic
1113788580 13:113015646-113015668 CTCCCTCAGACCCCAAGGCCCGG - Intronic
1113930293 13:113964749-113964771 TGCCCTCAGTCCCTCAGGCTCGG + Intergenic
1113956031 13:114100209-114100231 CGCCCTCAGCACCGCGGGCCGGG - Intronic
1113989999 13:114353557-114353579 TGCCCTCAGCCCGCCCGCCCGGG - Intergenic
1114494664 14:23124339-23124361 TGCCCTAGGCCCCACAGACCAGG + Intergenic
1114612446 14:24051818-24051840 TGCCCCCCGCCCCGAAGGCCCGG + Intergenic
1116972581 14:51081967-51081989 TGACCTCTGACCCCCAGGGCAGG - Intronic
1117547827 14:56807998-56808020 GCCCCGCAGCCCCGCAGGCCTGG + Intronic
1117670196 14:58098706-58098728 TGCCCTGTGCCTCCCAGCCCAGG - Intronic
1117699233 14:58396438-58396460 TTCCCTCAGCCGCCCGTGCCCGG + Intronic
1119193479 14:72700603-72700625 TGCCATCAACCACCCAGGCCTGG + Intronic
1119692886 14:76690791-76690813 TGCCAGCAGCCCCCCAGCCTTGG + Intergenic
1119739403 14:77004376-77004398 TGGCCTCTGCCCCACTGGCCAGG - Intergenic
1119814701 14:77555404-77555426 CGCCCTGGGCCCCACAGGCCGGG - Exonic
1120305278 14:82761922-82761944 TGCCCTCAACCCCCCAGCACAGG - Intergenic
1121122222 14:91383230-91383252 TGCCCTGGGCACTCCAGGCCTGG - Intronic
1122205242 14:100145075-100145097 TCCCTGCCGCCCCCCAGGCCAGG + Exonic
1122266687 14:100549965-100549987 GCCCCCCAGGCCCCCAGGCCTGG - Intronic
1122273598 14:100579748-100579770 TGGCCTCAGCCACCCAAGACAGG + Intronic
1122675410 14:103408596-103408618 TGCCTGCAGCCCACCAGGCCTGG + Intronic
1122688100 14:103519416-103519438 TGCCCTCAGATGCTCAGGCCTGG + Intergenic
1122871177 14:104639736-104639758 AACCCTCAGCCCCCGAGGCCAGG - Intergenic
1122885777 14:104709717-104709739 CGCCCTCAGACCCCAGGGCCTGG + Intronic
1122888178 14:104719796-104719818 GTCCCCCAGTCCCCCAGGCCAGG + Intronic
1122972089 14:105156499-105156521 TCCCCTCAGGCCCCCAAGACAGG + Intronic
1123052167 14:105549794-105549816 GCCCCGCCGCCCCCCAGGCCTGG + Intergenic
1123055446 14:105567125-105567147 TGACCTCTGCCCCGCAGACCCGG + Intergenic
1123060274 14:105591274-105591296 TGCCCTGAGCTGCCCTGGCCTGG - Intergenic
1123079898 14:105686969-105686991 TGACCTCTGCCCCGCAGACCCGG + Intergenic
1123438283 15:20271810-20271832 TGCCCTCAGCAGCCCAGCTCAGG + Intergenic
1123718066 15:23044055-23044077 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123718814 15:23046676-23046698 TCCCCTCAGCACCTCTGGCCAGG - Intergenic
1123718944 15:23047120-23047142 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123719158 15:23047863-23047885 TCCCCCCAGCACCCCTGGCCAGG - Intergenic
1123997552 15:25729476-25729498 TGGCCTCAGCTCCACTGGCCTGG + Intronic
1124514281 15:30352990-30353012 TCCTCTCAGAACCCCAGGCCAGG + Intergenic
1124662566 15:31562339-31562361 TGCCCTAAGCACTTCAGGCCAGG + Intronic
1124728638 15:32177774-32177796 TCCTCTCAGAACCCCAGGCCAGG - Intergenic
1125593888 15:40872452-40872474 TGCCCTCAATCCCCAAGGCCAGG - Exonic
1126093821 15:45073544-45073566 TGCCCTCATCCCCACAGTCTTGG + Exonic
1127836671 15:62796137-62796159 TGCTCTCGGCTCTCCAGGCCGGG + Exonic
1127901198 15:63342198-63342220 CCCCCTCAGCCCCCCAGACTAGG + Intronic
1128091482 15:64922046-64922068 TCCCCTCGGCTCCCCTGGCCTGG + Intronic
1128237701 15:66079075-66079097 TGCCCACTGCCCCTCAGACCAGG - Intronic
1128264015 15:66252579-66252601 TGCCCAGAGCCCCCGAGCCCGGG - Intronic
1129107240 15:73318795-73318817 TCCCCACAGCCCCAGAGGCCAGG + Intergenic
1129189775 15:73930515-73930537 TGAGATCAGACCCCCAGGCCTGG + Intronic
1129295940 15:74600137-74600159 GGCCTTCAGCCCCCAAGGCCAGG - Intronic
1129329882 15:74821625-74821647 AGCTCTCAGGCCCCCAGGCTGGG - Intronic
1129365319 15:75050510-75050532 TGCCCTCTGGCTTCCAGGCCAGG + Exonic
1129467354 15:75731531-75731553 TGCTCTCAGCCCGCCAGCCTGGG + Intergenic
1129481127 15:75827294-75827316 GGCTCTCAGCTCCCCAGACCAGG + Intergenic
1129719853 15:77872080-77872102 TGCTCTCAGCCCTCCAGCCTGGG - Intergenic
1129881058 15:79006153-79006175 TGCCCTCCTCCTCCCATGCCCGG - Intronic
1131531727 15:93199548-93199570 TACCCTCAGCCCCCGTGCCCAGG - Intergenic
1132004224 15:98212000-98212022 TGCCCTAAGCCACCCACACCTGG - Intergenic
1132453324 15:101980381-101980403 TACCCTCAGCCCGCCCGCCCGGG - Intergenic
1132453603 16:10419-10441 TACCCTCAGCCCGCCCGCCCGGG + Intergenic
1132671403 16:1103547-1103569 GCCCCTCAGGCCCCCAGGCTGGG + Intergenic
1132694128 16:1194571-1194593 TGCCTACAGCCCCCCAGCGCGGG + Intronic
1132731976 16:1367168-1367190 TCCCCACAGCCCCGCAGCCCCGG + Intronic
1132934087 16:2472289-2472311 GGACAGCAGCCCCCCAGGCCTGG + Exonic
1132987709 16:2776764-2776786 TGCCCTCGGCGCCCGGGGCCCGG + Intronic
1133102163 16:3486153-3486175 TGCCCCCTGCCCACAAGGCCAGG - Exonic
1133235627 16:4386145-4386167 TCCCCTCTGCCCCCGAGCCCTGG - Intronic
1133378520 16:5310099-5310121 TACACTCAGCCGCCCAAGCCAGG - Intergenic
1133529533 16:6641786-6641808 TGCCCTGAGCCTTTCAGGCCTGG + Intronic
1133982324 16:10642344-10642366 TGCTCTAATCACCCCAGGCCAGG + Intronic
1134036585 16:11036030-11036052 TGCTCTCTGCCTCCCAGGGCTGG + Intronic
1134094726 16:11411801-11411823 TCCCCTCACTCCTCCAGGCCAGG + Intronic
1134109642 16:11507089-11507111 TGCCCTGAGCCACCCCTGCCAGG + Intronic
1134117707 16:11561665-11561687 CTCCCTCAGGCCCCAAGGCCAGG + Intronic
1134291301 16:12904139-12904161 TGTCCCCAGCCCCACCGGCCAGG + Intronic
1134537814 16:15040743-15040765 TCCCCCCAGCACCCCAGGCCCGG - Intronic
1135495571 16:22948468-22948490 TGCGCTCTGCCCGCCAGTCCTGG - Intergenic
1136141840 16:28293216-28293238 CGCCCTGAGCCCCCGGGGCCGGG + Exonic
1136186487 16:28591541-28591563 TGCTCAGAGACCCCCAGGCCAGG - Intronic
1136348898 16:29694647-29694669 TTCTCTCTTCCCCCCAGGCCTGG + Exonic
1136750226 16:32628888-32628910 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1138264739 16:55652377-55652399 TGCCCTCAGGCCACCTGGCTGGG + Intergenic
1138320322 16:56105918-56105940 TGCTCACAGGCCCCCAGCCCAGG - Intergenic
1138516774 16:57540472-57540494 TCCTCTCAGGCCCCCAGGCAGGG - Intergenic
1139465293 16:67150899-67150921 TGCGCTGAGCCCCGGAGGCCAGG - Exonic
1139648682 16:68350727-68350749 TGTCCGCAGTCCCCCAGCCCTGG + Intronic
1139961826 16:70722315-70722337 TGCCATGGGTCCCCCAGGCCAGG + Intronic
1140137897 16:72224110-72224132 TGCCATCAGCAGCCCAGCCCTGG - Intergenic
1141482806 16:84318198-84318220 TGCCCCCAGCCCCCAAGCCTGGG + Intronic
1141700726 16:85640893-85640915 AGCCCTCTGGCCCCCGGGCCAGG - Intronic
1142024658 16:87806044-87806066 TGCCCCCACTCCCCCAGGCTGGG - Intergenic
1142213958 16:88821886-88821908 TGCCCCAGGACCCCCAGGCCAGG + Intronic
1203052357 16_KI270728v1_random:888093-888115 TGCCCACAGCTCCCCCGGGCTGG + Intergenic
1142644826 17:1304912-1304934 TACCCTCAGCACACCAGGCTGGG - Intergenic
1142889432 17:2933319-2933341 TGGTCTCTGCCCCCCAGGCAAGG - Intronic
1143150943 17:4807391-4807413 TGCCCCCGGCCCGCCTGGCCTGG + Intronic
1143181333 17:4986251-4986273 TCCCCCCGGCCCCTCAGGCCGGG - Exonic
1143368750 17:6425428-6425450 GGCCCACAGCCACCCAGGCAGGG - Exonic
1143386704 17:6535223-6535245 TGCCCTCTGCTCTCCAGCCCAGG - Intronic
1144638866 17:16926813-16926835 AGCCCTGGGCCCCACAGGCCAGG - Intergenic
1144703744 17:17354241-17354263 TGCTCTGAGCCCCTCAGGTCTGG - Intergenic
1144735414 17:17552907-17552929 TGCCCCCTTTCCCCCAGGCCAGG + Intronic
1144824632 17:18098908-18098930 TTCCCTCAGCCCCTGAGCCCCGG + Intronic
1146285838 17:31573681-31573703 TCCCCTCAGACCCCAAGGGCAGG - Intronic
1146913085 17:36660492-36660514 TGCCCTGAGGCCCCCAGGTAAGG - Intergenic
1147685871 17:42286672-42286694 GGCCCTCTGCCCTCCAGACCTGG + Intergenic
1147912010 17:43861560-43861582 TGCCCTCAAGGCCCCAGGCTGGG - Intronic
1148054606 17:44786723-44786745 TACACTCAGTCCTCCAGGCCTGG + Intergenic
1148081604 17:44970120-44970142 TGCCCTGAGCCCCCTACCCCTGG - Intergenic
1148178589 17:45587131-45587153 TGCCCTCCCCCTCCCAGCCCAGG + Intergenic
1148270564 17:46259324-46259346 TGCCCTCCCCCTCCCAGCCCAGG - Intergenic
1148717877 17:49728717-49728739 TGCCCTCACCCACCCTGGCCTGG + Intronic
1148733357 17:49851190-49851212 TGCCCTCGGCCACCCGGGCACGG + Intergenic
1149420922 17:56510549-56510571 TGCCCTGAGCCCCAGAGACCTGG + Intronic
1150294904 17:64002385-64002407 TGTCCTCTGCCCCCTGGGCCAGG + Exonic
1150643521 17:66964804-66964826 GGCCCTCGGCCCCCCAACCCCGG + Intergenic
1150654057 17:67028120-67028142 TGCCCTGAGCACACCAGTCCTGG - Intronic
1151356161 17:73559869-73559891 TGGCCTGATCCCCCCAGGGCTGG + Intronic
1151441703 17:74133505-74133527 TTCTCCCTGCCCCCCAGGCCAGG + Intergenic
1151479223 17:74360558-74360580 TGCTGCCAGCCCCCCAGGCAAGG + Intronic
1151497206 17:74466179-74466201 TTCCCTCAGCCCCGAAGCCCAGG + Intergenic
1151669796 17:75565724-75565746 TCCCCGCAGTCCCGCAGGCCAGG + Intronic
1151703220 17:75754085-75754107 TGCTCCCAGCCGCCAAGGCCCGG - Intronic
1151782810 17:76258542-76258564 GGCCCCCAGCTGCCCAGGCCAGG - Intergenic
1151907159 17:77056177-77056199 CGCCCTCAGCAGCCCAAGCCGGG + Intergenic
1151954353 17:77373179-77373201 GGGCCCCAGCCCCCCAGGCCTGG + Intronic
1151961840 17:77409704-77409726 TACCCGCCGCCTCCCAGGCCCGG + Intronic
1152036723 17:77877974-77877996 TGCCCTCAGAGCCCCAGGCAGGG - Intergenic
1152076212 17:78161443-78161465 TGCCCTCAGGGCCCCAGCCAGGG - Intronic
1152208983 17:78992983-78993005 TGCCCACAGCTGCACAGGCCAGG - Exonic
1152225122 17:79089298-79089320 TGCCCTCCACCCACCATGCCCGG + Intergenic
1152259785 17:79260689-79260711 TCCCATCAGGCCCCAAGGCCGGG - Intronic
1152274782 17:79349854-79349876 TTCCCTGAGCCCCCCGGGGCAGG + Intronic
1152463902 17:80455162-80455184 AGCCCTCAGGACCTCAGGCCAGG - Intergenic
1152587185 17:81194325-81194347 AGCCCTGAGCCCCACAGGCTGGG - Intronic
1152627380 17:81393841-81393863 GGCCCGCAGCCCCCCACCCCAGG + Intergenic
1152639770 17:81444651-81444673 TGCCCTCTGCCTCCCAGGCCTGG + Exonic
1152693568 17:81732945-81732967 TGTCATCTGCCACCCAGGCCAGG + Intergenic
1152754552 17:82081838-82081860 TGCCCCCTCCCCCACAGGCCTGG - Exonic
1152755418 17:82085109-82085131 GGCCTTCAGCCACACAGGCCGGG + Exonic
1152861421 17:82698624-82698646 TGCGCTCAGCCCCGCAGGCCGGG - Exonic
1152911968 17:83010122-83010144 TGCCCACAGCACCCCACACCAGG - Intronic
1153052316 18:910599-910621 TGCCCTCAGCTTCCCAGACCTGG - Exonic
1155167506 18:23243333-23243355 CGCCCTCAGGCGCACAGGCCTGG + Intronic
1157860017 18:51133012-51133034 TGGATTCTGCCCCCCAGGCCGGG + Intergenic
1159013583 18:63082729-63082751 TGCCCTCACCCCCACCTGCCAGG + Intergenic
1159629061 18:70728151-70728173 TGCCCTAATCACCCCAGGCCCGG + Intergenic
1160371518 18:78376160-78376182 TGCCCTCGTCCACCAAGGCCGGG - Intergenic
1160372978 18:78390010-78390032 TGTCCTCTGCCCCTCAGCCCTGG - Intergenic
1160377440 18:78423644-78423666 GGCCCTCAGCCCCCATGGCTTGG - Intergenic
1160653385 19:246368-246390 TGCCCTCAGCCCGCCCGCCCGGG + Intergenic
1160666912 19:335229-335251 GGCCCTCAGGCCCCCAGCCTTGG - Intronic
1160723683 19:608385-608407 TCCCCTCAGACCCCGGGGCCGGG - Intronic
1160740050 19:681425-681447 TGCCCTGTGCCCTCCAGCCCCGG + Exonic
1160773937 19:846260-846282 TGCCCACGACCCCCCAGCCCAGG + Exonic
1160834801 19:1119636-1119658 TGCCGTCAGCTCCCCAACCCGGG + Intronic
1161231448 19:3176927-3176949 TCCCCTCAGACCCCAAGGCAGGG + Intronic
1161327444 19:3670589-3670611 TGCTCCAAGCCCCCCAGTCCCGG + Intronic
1161482820 19:4519299-4519321 TGGCCCAAGCCCCCCAGGCTGGG - Intergenic
1161489791 19:4555623-4555645 CTCCCTCAGCCCCCCACTCCAGG + Intronic
1161518930 19:4712944-4712966 TGTCCTCAGCCCCTGAGCCCAGG - Intronic
1161587914 19:5115379-5115401 TCCCCCCAACCCCCAAGGCCAGG + Intronic
1161743040 19:6036241-6036263 TGCCATTAGCACCCCAGGCCAGG - Intronic
1161821115 19:6531742-6531764 CCCCATCAGCACCCCAGGCCAGG + Intronic
1162019321 19:7861509-7861531 TGCCCTCTGGCCCCCAGGCCAGG - Intronic
1162063178 19:8109175-8109197 TGACCTAAGCCACCGAGGCCCGG - Intronic
1162439953 19:10686724-10686746 TGCCCTCTGCCAGCCAGGCTGGG + Intronic
1162542036 19:11302951-11302973 TGGCCTCAGCCGCCCCGTCCGGG + Intronic
1162801470 19:13113031-13113053 GGTCCTCAGCCTCCCACGCCAGG + Intronic
1163231440 19:16005757-16005779 TGCCCTCACCCCCGCAGTCTTGG + Intergenic
1163266798 19:16226846-16226868 TGCTCTCTCCCTCCCAGGCCAGG + Intronic
1163490091 19:17612449-17612471 TGCCCCCAGCATCCCATGCCTGG + Intronic
1163813972 19:19452577-19452599 TCACTTCACCCCCCCAGGCCTGG - Intronic
1164371172 19:27645591-27645613 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1164752134 19:30664830-30664852 AGCCCTCAGCCCTCCCAGCCGGG - Intronic
1165058596 19:33194360-33194382 TGCGCCCAGCCCGCCCGGCCGGG - Intronic
1165318991 19:35074495-35074517 TCCCCTCAGAGCCCCAGGGCAGG - Intergenic
1165830661 19:38728774-38728796 AGCCCCCAGTGCCCCAGGCCGGG - Intronic
1165844413 19:38809034-38809056 TGTCCTCGGCCTCCCTGGCCCGG + Intronic
1166000215 19:39873186-39873208 TGCCTTCAGACCCCCAGGGCAGG + Intronic
1166343481 19:42151736-42151758 TGCCCTCCCCCACCCAGGTCAGG + Intronic
1166435281 19:42762307-42762329 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1166452546 19:42914510-42914532 TGCCCCCAGCTCCACAGTCCAGG + Intronic
1166887665 19:45971849-45971871 TTCCCTGAGCCCCCCACGGCAGG + Intronic
1166938701 19:46350274-46350296 ATCCCTCAGCCCCCAAAGCCCGG - Intronic
1167048783 19:47066739-47066761 TGCCCTCAGCACCCTTGGGCTGG + Exonic
1167166471 19:47802975-47802997 TCCCCTCTGCCCCCCAGGTGTGG - Exonic
1167175372 19:47860785-47860807 TCCCCTCTGCCCCCCAGGTGTGG + Intergenic
1167238262 19:48327736-48327758 GGCACTCAGCCACTCAGGCCTGG - Intronic
1167292107 19:48630073-48630095 CGCCCTCAGCCATCCTGGCCGGG - Exonic
1167431648 19:49458664-49458686 TGCCCTCAGGGCCCTAGGCAAGG - Intronic
1168305497 19:55433125-55433147 AGGCCGCAGCCCCCCAGACCCGG + Exonic
1168728773 19:58607389-58607411 TGCCCTCAGCCCGCCCACCCGGG - Intergenic
925193219 2:1902377-1902399 TGCCGGCAGCACCCCAGGCTGGG + Intronic
925906501 2:8542917-8542939 AGCCCTTAGCTCCCGAGGCCAGG + Intergenic
926037281 2:9645706-9645728 TGGCATCAGGCCCCCAGTCCTGG + Intergenic
926054843 2:9768477-9768499 CGCCCTCAGCCACCAAGGCCAGG - Intergenic
926170933 2:10552238-10552260 TGCCTACAGCCCCCGAGCCCAGG - Intergenic
926682014 2:15671266-15671288 TGTCCACAGCCTCCCAGCCCGGG - Intergenic
926958950 2:18332722-18332744 AGCCCTGACCCCCCCAGGCTAGG - Intronic
927905161 2:26849837-26849859 TGTCTGCAGGCCCCCAGGCCGGG - Intronic
928975612 2:37083857-37083879 TGACCTCAGTCCCTCTGGCCAGG - Intronic
931173936 2:59834027-59834049 CTCCCTCAGCACCCCAGGCTGGG + Intergenic
932219569 2:69989472-69989494 GGCCCACAGCCCCCCATTCCTGG - Intergenic
932373491 2:71213044-71213066 TCCCCACTGCTCCCCAGGCCAGG - Intronic
933727277 2:85434072-85434094 TGCCCTCAGGCCCTCTGCCCAGG + Intronic
934020542 2:87947190-87947212 TGCACTCAGCTCCATAGGCCAGG + Intergenic
934716736 2:96549117-96549139 AGCTCTCAGCGCCCCAGGACAGG - Intronic
934993167 2:98935824-98935846 TGCCCTCGACCCCCTAGCCCCGG + Intronic
935332267 2:101985844-101985866 TACCCTCATCACCCCGGGCCAGG - Intergenic
935687326 2:105695764-105695786 TCCCCTCCTCCCGCCAGGCCTGG - Intergenic
935862234 2:107345571-107345593 TGCCCTCAGACCCACCAGCCCGG + Intergenic
936047129 2:109196644-109196666 AGACCTCAGCCAGCCAGGCCAGG - Intronic
936161259 2:110085820-110085842 TACCCTCAGCCCCACTGCCCAGG + Intronic
936183404 2:110285534-110285556 TACCCTCAGCCCCACTGCCCAGG - Intergenic
936444408 2:112584902-112584924 TGCCCCCAGTACCCCAGGTCCGG + Intronic
936569805 2:113603566-113603588 TGCCCTCAGCCCGCCCGCCCGGG + Intergenic
936992986 2:118385875-118385897 GGCCCTGAGCCAGCCAGGCCAGG - Intergenic
937239142 2:120449223-120449245 TGCCCTGAGCTCCCCTGGGCAGG - Intergenic
937346913 2:121131871-121131893 TGCACACAGCCCCGGAGGCCTGG - Intergenic
938052886 2:128191196-128191218 TGCCCTCACCCTCCTAAGCCAGG + Exonic
938085393 2:128396546-128396568 TGTCCACAGCTCCCCAGTCCTGG - Intergenic
938133320 2:128735314-128735336 CGCCCTCAGCCCCACTGGCCTGG - Intergenic
938250672 2:129813254-129813276 TGCCTACAGCCTCCCATGCCTGG + Intergenic
938273255 2:129993562-129993584 TTCCCTCGGCCCCCCATGCCCGG + Intergenic
938376975 2:130814354-130814376 TGCCCTGGGCCCCGCAGGCCAGG - Intergenic
942324501 2:174764551-174764573 TGCCCTCAGCCCTGGAGCCCAGG + Intergenic
942612645 2:177757770-177757792 TCACCTCATCCCCCCAGGCTGGG - Intronic
944464037 2:199982633-199982655 TGCCCTCAGATGCCAAGGCCTGG - Intronic
944669500 2:201983567-201983589 TGCCCTCTGACCCCACGGCCAGG + Intergenic
945360425 2:208889749-208889771 TGTCCTCTGGCACCCAGGCCTGG - Intergenic
946157523 2:217816798-217816820 TGCCCTGAGCCTGCCAAGCCAGG - Intronic
946330476 2:219006114-219006136 TGCCCCCAGCCACCCTCGCCAGG - Exonic
946404023 2:219483433-219483455 GGCCCTCCCCTCCCCAGGCCAGG + Exonic
946465825 2:219911078-219911100 TGTCCTCATCCCACCAAGCCAGG + Intergenic
947594012 2:231399695-231399717 AGCCCCCACACCCCCAGGCCTGG + Exonic
947717440 2:232349031-232349053 TGCCCTGGGCCAGCCAGGCCTGG - Intergenic
947726733 2:232406115-232406137 TGCCCTCGGCCAGACAGGCCTGG - Intergenic
947765280 2:232633785-232633807 TCCCCTCGGCGCCCCAGCCCCGG + Exonic
947926254 2:233925066-233925088 TGCTCTCAGACCCTCAGCCCAGG - Intronic
948375888 2:237519995-237520017 TGTCCTCAGTCCCTGAGGCCAGG + Exonic
948487061 2:238288019-238288041 CGCCCTCAGGTTCCCAGGCCTGG + Intronic
948604194 2:239124306-239124328 TGCCCGCAGCAGCCCAGGCCTGG + Intronic
948927920 2:241111199-241111221 TGGCCTCAGGCCACCAGGTCAGG + Intronic
949088996 2:242182919-242182941 TGCCCTCAGCCCGCCCGCCCGGG - Intergenic
1169197827 20:3692892-3692914 TGCCCGCAGCCCTCTGGGCCAGG - Exonic
1169509657 20:6249816-6249838 TGCCCTCATCACCCCAGGGCTGG - Intergenic
1170757027 20:19213300-19213322 CTCCATCAGCCCCCAAGGCCAGG + Intronic
1170771831 20:19339676-19339698 GGCCCTCAGCCCCCAAGTCTTGG - Intronic
1171252165 20:23656613-23656635 TTCCCTCAGCCCCTGAGGTCTGG + Intergenic
1171399091 20:24860108-24860130 TGCCATCAGCACCCCCTGCCTGG + Intergenic
1172306865 20:33886942-33886964 TGCCCTCAGAAACCCACGCCTGG + Intergenic
1172887441 20:38240722-38240744 TCCCCTGAGCCCCCCACTCCTGG - Exonic
1174669831 20:52296769-52296791 TGCCCTGTGTCCCCCAGACCAGG - Intergenic
1174752548 20:53126075-53126097 TGTCCATAGGCCCCCAGGCCAGG + Intronic
1175256981 20:57653422-57653444 TGGCCTCAGCCCCTCACCCCTGG + Intronic
1175770106 20:61618166-61618188 TGCCTTCAGCCACCCAGCCGAGG - Intronic
1175771772 20:61628601-61628623 GGCCTCCAGCCCCACAGGCCGGG + Intronic
1176045344 20:63089733-63089755 TGCCCTCAGGACCGCGGGCCAGG + Intergenic
1176119247 20:63446576-63446598 TGCCCCCAGCCCCACAGCCCGGG - Intronic
1176131648 20:63498971-63498993 CACCCTCTGCCCCCCAGGACCGG + Intronic
1176190696 20:63808327-63808349 TGCGCTCAGCCCCCGGGGCAAGG - Intronic
1176254901 20:64146748-64146770 TCCCCTCAAGACCCCAGGCCTGG + Intergenic
1177248962 21:18567978-18568000 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1178778983 21:35581113-35581135 TGCCCTGAGCCCTCCAGCCTTGG - Intronic
1179485884 21:41710565-41710587 TGCCACCAGCCTCCCAGGGCTGG - Intergenic
1179511935 21:41879144-41879166 TGCCCCCCGCCCCCCGCGCCCGG - Intronic
1179533822 21:42038642-42038664 TGCCCTCAGCCCCACAATCCCGG + Intergenic
1179560734 21:42214583-42214605 TGCCCTCGTCATCCCAGGCCGGG - Intronic
1179628280 21:42660764-42660786 TGCACTCAGCCACCCAGGGGTGG + Intronic
1179708360 21:43195295-43195317 TGGCCTCAGCCCTCCTGTCCTGG + Intergenic
1179718632 21:43302954-43302976 TGTCCTGAGCTCTCCAGGCCGGG - Intergenic
1179720620 21:43314204-43314226 TGCCCTGAGGCCACCAGGCCAGG - Intergenic
1180004335 21:45013153-45013175 TGCCTTCACCTCCCCAGGACTGG - Intergenic
1180030490 21:45203237-45203259 TGTCCCCTGCCCCCCAGGCTGGG + Intronic
1180264250 21:46699457-46699479 TGCCCTCAGCCCGCCCGCCCAGG - Intergenic
1180837915 22:18940482-18940504 TGCCCCCAGCACCACAGGGCAGG + Intergenic
1181036782 22:20173536-20173558 TGCCCTCGGCTCCGCAGACCCGG - Intergenic
1181041303 22:20193946-20193968 AGCCCACAGCCCTGCAGGCCGGG + Intergenic
1181771800 22:25131209-25131231 TGGCCTCAGCTCTCCAGGGCTGG - Intronic
1181909553 22:26227836-26227858 TGGCCTCTGCCCTCCAGGACTGG + Intronic
1182424798 22:30266348-30266370 GGCCCTGGGGCCCCCAGGCCTGG + Intronic
1182472708 22:30558450-30558472 GGCCCTCCCTCCCCCAGGCCTGG + Intronic
1183020013 22:35019358-35019380 AGCACTCAGACACCCAGGCCAGG + Intergenic
1183032676 22:35117481-35117503 TGCCCTCAGCACCCCACTCCTGG + Intergenic
1183339925 22:37274371-37274393 TGCGCTCAGCCCCTGTGGCCAGG - Intergenic
1183540482 22:38426782-38426804 TGCCATCTGACCTCCAGGCCCGG - Exonic
1184452298 22:44590472-44590494 TGCCCGCAGCCCCTCAGCCCTGG - Intergenic
1184644597 22:45889194-45889216 AGCACTGAGCCCCCCAGGACAGG + Intergenic
1184768815 22:46586431-46586453 TGCCCTCCCCTCCCCAGCCCAGG + Intronic
1184872877 22:47251974-47251996 TGCCCTCAGCCATCCCTGCCTGG + Intergenic
1185077269 22:48690159-48690181 TGTCCTCAGCCTGCCAGGCAAGG + Intronic
1185142969 22:49113504-49113526 GGGCCTCAGCTACCCAGGCCTGG + Intergenic
1185179376 22:49350299-49350321 AGCCCTCATCGCCCCGGGCCAGG - Intergenic
1185430411 22:50807403-50807425 TGCCCTCAGCCCGCCCGCCCAGG - Intergenic
950465506 3:13150990-13151012 TGCCCTCATCCTCCTGGGCCAGG + Intergenic
950486625 3:13277863-13277885 TGCCCTCAGCCCCCCGCCCCTGG + Intergenic
950496147 3:13335696-13335718 ACCCCCCAGCCCCCCAGTCCTGG + Intronic
950519269 3:13486916-13486938 TCCCCTCCACCCTCCAGGCCTGG - Intronic
951040229 3:17981548-17981570 TGCCCTCAGCACCCCACCCATGG - Intronic
951844769 3:27073482-27073504 TGCCCACAGCCCAGCAGACCAGG + Intergenic
952026181 3:29085752-29085774 TTCACTCTGCCACCCAGGCCTGG + Intergenic
952265003 3:31776771-31776793 TTCCCTCCTCCCCCCAGCCCTGG - Intronic
953391180 3:42534759-42534781 TGCCCCCAGCCCTCCTGGCCTGG - Intronic
953883934 3:46705084-46705106 TCCCCTCAGTCCCCCAGGGCAGG + Intronic
953914059 3:46906677-46906699 TCCCCTCAGACCCCCAGAGCAGG - Intergenic
954389451 3:50260989-50261011 TGCCTGCAGCCCCCCATGGCTGG - Intergenic
954581957 3:51707696-51707718 CCCCCTCAGCTCCCCAGGGCAGG - Intronic
954613042 3:51956258-51956280 TGCCCTGAGGCCCCCACGGCCGG + Exonic
954616387 3:51970804-51970826 TGGCCCCACCCCCTCAGGCCAGG - Intronic
954628646 3:52036366-52036388 TGCTCTCATCCCCCAGGGCCTGG + Intergenic
954857740 3:53660979-53661001 TGGCTCCAGGCCCCCAGGCCAGG + Intronic
955229379 3:57085384-57085406 CGCCATCAGCTACCCAGGCCAGG + Intergenic
960028164 3:113031613-113031635 TGCCCCCAGCACCACAGGGCAGG - Intergenic
961042798 3:123689176-123689198 TGTCCCCAGCCACCCTGGCCAGG - Intronic
961296899 3:125892102-125892124 TGCCCCCAGCACCACAGGGCAGG + Intergenic
961431838 3:126889217-126889239 TGCCCTCAGCAGCCCTGCCCTGG - Intronic
961603648 3:128078090-128078112 TGCCCACAGCCCTCCAGAGCAGG + Intronic
961635367 3:128329672-128329694 TGCCCTCAGCACCCTAAGCTTGG - Intronic
961769825 3:129240863-129240885 TGCCCTCAGATCCCCAGACCAGG + Intergenic
963511129 3:146250886-146250908 CGCCCTCGGCCCCGCAGCCCGGG + Intronic
963696027 3:148566747-148566769 TGCCCCCAGCACCACAGGGCAGG - Intergenic
966301105 3:178480486-178480508 TGCCCCCAGGCACCCAGGCTGGG - Intronic
966743383 3:183254034-183254056 GGCCCGCAGCCCCCAATGCCGGG - Intronic
967026596 3:185569901-185569923 TGCCCCCAGCACCACAGGGCAGG - Intergenic
967826326 3:193880493-193880515 TGTCCTCAGCTGCCCAGGCCAGG + Intergenic
968284980 3:197503206-197503228 CGCCCTCAGCCCCACAGGACTGG + Intergenic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968632836 4:1661105-1661127 TGCTCTCCGCCCCTCAGCCCGGG + Intronic
968690349 4:1986896-1986918 TGCCATCAGCACACCGGGCCAGG + Intronic
968705281 4:2074764-2074786 TGCCCCCAGTTCTCCAGGCCAGG - Intronic
968905197 4:3447671-3447693 GGCCCTGTGCTCCCCAGGCCAGG + Intronic
969054134 4:4391015-4391037 TGTCCACAGCCCTCCAGGACTGG - Intronic
969153875 4:5193097-5193119 TGCCCTCATTCCCCCAGGCATGG - Intronic
969311258 4:6354099-6354121 TGCGCTCTGCCCCTCAGCCCAGG + Intronic
969346941 4:6575750-6575772 CGTCCTCCGCCCCCCAGGACAGG + Intronic
969447372 4:7253056-7253078 TGGGCTCAGCCCCCCATGGCTGG + Intronic
970651121 4:18179093-18179115 CTCCCCCAGCCCCCCAGCCCCGG - Intergenic
970768703 4:19583940-19583962 TGACCACAGCCCTCCAAGCCAGG - Intergenic
974432523 4:61817107-61817129 TACCTTCAGCCCCCCAAACCTGG - Intronic
974676798 4:65101809-65101831 TGGCCTCAGCCTCCCAAGCAGGG + Intergenic
978759649 4:112343003-112343025 TCCCTTCAGCTCCCCAGTCCTGG + Intronic
982388601 4:154839262-154839284 TTCCCTCAGCCCCCCATCACTGG - Intergenic
982876760 4:160660427-160660449 TGCCCCCAGCACCACAGGGCAGG + Intergenic
984754730 4:183314501-183314523 TGATCTCACCACCCCAGGCCAGG - Intronic
984796824 4:183669378-183669400 TGGCCTCAGCTCTCCAGGCCTGG + Intronic
985466817 4:190204121-190204143 TGCCCTCAGCCCGCCCGCCCGGG - Intergenic
985593356 5:776468-776490 TCCCCTCAGCCCTGCTGGCCAGG - Intergenic
985602014 5:840386-840408 AACCCTGAGCCCCCCACGCCTGG - Intronic
985631257 5:1015255-1015277 TGCCCACAGCCTCCCTGGCGTGG + Intronic
985640788 5:1062667-1062689 GCCCCCCAGCCCCCCAGCCCTGG - Intronic
985670058 5:1202356-1202378 TGCCCTCAGGCCTGGAGGCCGGG + Intronic
985685475 5:1279566-1279588 TGTCCCCAGCCACCCAGACCCGG + Intronic
985689692 5:1300244-1300266 CAGCCTCAGCCTCCCAGGCCGGG + Intergenic
985775179 5:1837655-1837677 GGCCCCCTGCCACCCAGGCCCGG + Intergenic
985864905 5:2507011-2507033 TGCACTCAGCCCACGAGGGCAGG + Intergenic
986721281 5:10563348-10563370 GGCCCACAGCCCCTCTGGCCCGG - Intergenic
986997214 5:13620924-13620946 TGGCCTCTTCACCCCAGGCCAGG + Intergenic
989055014 5:37358335-37358357 TGGCCTCACACCCCCATGCCTGG - Intronic
989101385 5:37826477-37826499 TGCCCACAACCCACCATGCCAGG - Intronic
990557557 5:56951614-56951636 TGCCCCCGGCCCACCGGGCCCGG - Intronic
990726019 5:58755563-58755585 TGCCATCAGCCACCCTTGCCTGG - Intronic
991960015 5:72035053-72035075 TGCAGACAGCTCCCCAGGCCTGG + Intergenic
991969175 5:72122217-72122239 TGCCCTGAGCCCTCCTGGCCCGG + Intronic
997335865 5:133108813-133108835 TGGCCTCAGCCGCCCCGTCCGGG + Intergenic
998400206 5:141844801-141844823 TGCCCTCTGCCCACAAGGTCTGG - Intergenic
999261309 5:150240594-150240616 TTCCCTCAGCTCTCCAAGCCAGG + Intronic
999317386 5:150593165-150593187 TGGCCTTAGGCCCCCAGACCAGG + Intergenic
999702023 5:154236916-154236938 AGGCCTCAGCCTGCCAGGCCTGG + Intronic
999952428 5:156665055-156665077 TGCCCCCAGCACCACAGGGCAGG - Intronic
1001274270 5:170339007-170339029 TACCATCAGCCCACCTGGCCAGG - Intergenic
1001454167 5:171848143-171848165 TGCCCTCCGCCCCCAGGGCCTGG + Intergenic
1001820249 5:174704658-174704680 TGCCATCAGCTGGCCAGGCCAGG - Intergenic
1001986343 5:176076670-176076692 TGGCCTCATCACCCCAGGCTAGG + Intronic
1002026901 5:176401889-176401911 TGCCCTCACCGCCCCTGGCCTGG + Intronic
1002089872 5:176798058-176798080 CGCCCTCAGGACCCCACGCCGGG - Intergenic
1002105072 5:176876005-176876027 TGCTCTTCGCTCCCCAGGCCGGG + Intronic
1002230525 5:177761454-177761476 TGGCCTCATCACCCCAGGCTAGG - Intronic
1002264811 5:178022294-178022316 TGGCCTCATCACCCCAGGCTAGG + Intronic
1002467322 5:179414060-179414082 TGCCCCGAGAGCCCCAGGCCTGG - Intergenic
1002845053 6:938489-938511 TGCCCTAATCCCCCAGGGCCAGG + Intergenic
1002888714 6:1316866-1316888 TGTGCCCAGGCCCCCAGGCCTGG + Intergenic
1003870588 6:10399561-10399583 CCTCCCCAGCCCCCCAGGCCAGG - Intronic
1004154229 6:13152980-13153002 TGTCCTCAGCACTCCAGGGCCGG - Intronic
1004206737 6:13598428-13598450 TGCTCACAGCCACCCAGACCTGG - Intronic
1004280482 6:14275814-14275836 TGCCCTAACCCCCACAGGCAGGG - Intergenic
1004351382 6:14893182-14893204 TGACCTCAGCCCCCAGGGCCAGG - Intergenic
1005554189 6:26956633-26956655 TGCCCCCCGCCCCCCAGCCGCGG - Intergenic
1005755304 6:28920745-28920767 TACCCCCAGCCTCCCAGGCCAGG - Intronic
1005863099 6:29916449-29916471 TGCACTCATCCTACCAGGCCTGG - Intergenic
1005874679 6:30001959-30001981 TGCACTCATCCTACCAGGCCTGG - Intergenic
1006407432 6:33853326-33853348 TTCCGTGGGCCCCCCAGGCCAGG - Intergenic
1006429153 6:33984503-33984525 TTCCCCCAGCGCCCCTGGCCTGG - Intergenic
1006441512 6:34056467-34056489 CGGCCTCAGGCCCCCAGGCTCGG + Intronic
1007114596 6:39334669-39334691 TGCCCTCAGCCCTCTAGAGCTGG - Exonic
1007358967 6:41341943-41341965 TGCCCGTAGCCACACAGGCCTGG + Intronic
1010592215 6:77724544-77724566 TGCCCCCAGCACCACAGGGCAGG - Intronic
1010619698 6:78059791-78059813 TGTCTTCAGCCACCCAGACCAGG + Intergenic
1013457103 6:110340207-110340229 GCCCCTCAGCAACCCAGGCCTGG - Intronic
1015845241 6:137513438-137513460 TGGCCTGAGCCCAGCAGGCCGGG + Intergenic
1016547451 6:145240381-145240403 TGCCCCCAACCCCCCAACCCCGG + Intergenic
1017070706 6:150573366-150573388 TGCCCCCAGCCCCCCTGCCTGGG - Intergenic
1017140304 6:151183986-151184008 TGCCCTTACCACCCCAGGGCTGG + Intergenic
1017453688 6:154578350-154578372 TGCCCTCTTAGCCCCAGGCCTGG + Intergenic
1017815673 6:158014850-158014872 TACCCTCAGCCCCCCAGGAGTGG - Intronic
1018003276 6:159598189-159598211 TGGCCTCAGCCTCCCGGGCTGGG - Intergenic
1018017897 6:159727903-159727925 TGTCCTCCGTCCCCAAGGCCCGG + Intronic
1019188073 6:170232626-170232648 TGCCCTCATCCCCCCCACCCAGG - Intergenic
1019298116 7:289806-289828 TGCCCTGAGCGCCCCAGGAAGGG + Intergenic
1019481857 7:1270578-1270600 TGCCCTCAGCACCCCTGGGAAGG + Intergenic
1019490466 7:1310959-1310981 TGCCCTAAATCACCCAGGCCAGG + Intergenic
1019507944 7:1402632-1402654 TGCGCCCAGCACCCCAGGCTTGG + Intergenic
1019528881 7:1493958-1493980 TGTCCTCGGCCCCTCAGGTCTGG - Intronic
1019601218 7:1884742-1884764 CGCCCTGAGGCCCCCAGCCCAGG + Intronic
1019603172 7:1895426-1895448 TGCCCAGAGCTCCCCATGCCAGG + Intronic
1019630493 7:2046378-2046400 TGTCCTCCTCCTCCCAGGCCCGG + Intronic
1019713859 7:2529580-2529602 TGCCAGCCGCCCCCAAGGCCAGG - Intergenic
1019976889 7:4590067-4590089 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1019977824 7:4598570-4598592 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1020697813 7:11437130-11437152 TTCCCAGAGCCCCTCAGGCCAGG - Intronic
1021945823 7:25726296-25726318 AGCCCTTAGCTCTCCAGGCCAGG + Intergenic
1022515868 7:30974684-30974706 TTCCCCCAGCCCCACAGCCCTGG - Intronic
1022534008 7:31084647-31084669 TGCACCCAGTCTCCCAGGCCAGG - Intronic
1022663601 7:32387875-32387897 TGTCCTCAGCCGCCCCGTCCGGG - Intergenic
1023700581 7:42888548-42888570 TGCCCTCCGCGCCGCAGGCAAGG - Intergenic
1023819761 7:43974064-43974086 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1023864786 7:44233511-44233533 TCCCCTGAGAACCCCAGGCCAGG - Intronic
1024701299 7:51906905-51906927 AACCCACAGCCCCCCAGTCCTGG - Intergenic
1025098506 7:56116173-56116195 TGCGCCCTGCCCCGCAGGCCGGG + Exonic
1026827852 7:73595434-73595456 TGCTCCCAGCCCCCCATCCCTGG + Intronic
1027185425 7:75968161-75968183 TGCCCTCATGCCCCTTGGCCAGG + Intronic
1029124537 7:98287326-98287348 TGGCCTGAGCCCCTCAGTCCAGG - Intronic
1029570084 7:101363301-101363323 TGCCCTGCGCCCCCAAGTCCCGG - Intronic
1029649232 7:101879587-101879609 TGGCCTCAGGCCTCCAGGGCAGG - Intronic
1029748034 7:102527517-102527539 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1029967173 7:104751960-104751982 TGCCCCCAGCACCACAGGGCAGG - Intronic
1031442667 7:121812715-121812737 TGTTCTGAGCCACCCAGGCCTGG - Intergenic
1034093115 7:148382203-148382225 TGCTCACAGCCCCACAGGCCTGG + Intronic
1034433409 7:151051919-151051941 TGCCCACACCCCCCCAGCCCTGG - Intronic
1034888896 7:154822082-154822104 TGCCCTCAGAGCCCCAGGGAAGG - Intronic
1034939001 7:155218451-155218473 TGCCCTGGGCCTGCCAGGCCTGG + Intergenic
1035056539 7:156039951-156039973 TGCACTCTGCGCCCGAGGCCTGG - Intergenic
1035512908 8:206102-206124 TGCCCTCAGCCCGCCCGCCCGGG + Intergenic
1035727005 8:1830999-1831021 TGCCTTCGGCCCTCCAGCCCTGG - Intronic
1035752824 8:2008163-2008185 TGCACTCACCCCCCCACCCCAGG + Intergenic
1035753171 8:2009761-2009783 TGCACTCAGCCCCCCACCCCAGG + Intergenic
1036292432 8:7505515-7505537 TGCCCCCAGCACCACAGGGCAGG - Intronic
1036705454 8:11043027-11043049 GGGCCCCAGCCCCCCAGGGCTGG - Intronic
1037818623 8:22125014-22125036 TCCTGTCAGCCCTCCAGGCCCGG + Intronic
1037824710 8:22154489-22154511 GTCCCTCGGCCTCCCAGGCCTGG + Intronic
1038401504 8:27287882-27287904 GGCCCTCAGCGCCCGAGTCCTGG + Exonic
1040555464 8:48474085-48474107 TGCCTTCAGCCTGCCTGGCCTGG + Intergenic
1044781643 8:95749904-95749926 TGCCCTCAGCCCCTCACCTCGGG + Intergenic
1048947397 8:139462131-139462153 TGCCCCCAGCACCACAGGGCAGG - Intergenic
1048992750 8:139770890-139770912 TTCCCTACGCCCGCCAGGCCCGG - Intronic
1049227942 8:141466602-141466624 TGCCTTCAGGCTCCCAGGGCAGG - Intergenic
1049385537 8:142341263-142341285 TGCACCCACCCCCCCAGGCCTGG + Intronic
1049444493 8:142623794-142623816 TGCCCTCTGCTCCCCACTCCAGG + Intergenic
1049464694 8:142745512-142745534 TCACCTCAGCCCACAAGGCCAGG - Intergenic
1049478267 8:142806898-142806920 ACCCCACAGTCCCCCAGGCCTGG - Intergenic
1049553431 8:143271040-143271062 AGTCCCCAGCCCCACAGGCCTGG + Intronic
1049614961 8:143572054-143572076 TGTCCTCAGCCCTGGAGGCCCGG - Exonic
1049653890 8:143789353-143789375 TGTCCTCAGGCCCCTGGGCCAGG + Intergenic
1049654827 8:143792854-143792876 TCCCCCCAGCCCCCCACGCCTGG - Exonic
1049689186 8:143951302-143951324 ATCCCTCATCCCTCCAGGCCTGG - Intronic
1049797413 8:144503053-144503075 GCCCCTCTGGCCCCCAGGCCGGG - Intronic
1049883011 9:10836-10858 TACCCTCAGCCCGCCCGCCCGGG + Intergenic
1050113846 9:2242724-2242746 TGCCCTCAGCACCTCAGGGAGGG - Intergenic
1051367535 9:16331807-16331829 GGCCCTGGGCACCCCAGGCCGGG - Intergenic
1051600408 9:18866891-18866913 TGCCCTTATCCACCTAGGCCAGG + Intronic
1053468799 9:38330445-38330467 TGCCCTCAGACACAAAGGCCTGG + Intergenic
1056081808 9:83102782-83102804 TGTCCTCATCACCCCAGGGCAGG - Intergenic
1056450901 9:86715862-86715884 TGAACACAGCCCTCCAGGCCGGG - Intergenic
1057171295 9:92964812-92964834 TACCCCCCGCCCCCCAGGCCTGG - Intronic
1057197972 9:93125573-93125595 TGCCCTAATGCCCACAGGCCAGG + Intronic
1057212201 9:93206378-93206400 TGCCCTCAGCCACCAAGGCCAGG - Intronic
1057500428 9:95593556-95593578 TGCCTTCTGCCTCCCTGGCCAGG - Intergenic
1059949213 9:119444476-119444498 AGCCCTCATCCCTCCAGCCCTGG - Intergenic
1060050228 9:120373424-120373446 GGCCCTCAGCCCAACAGCCCAGG + Intergenic
1060481224 9:124017837-124017859 TTCCCGCAGCCCCTCGGGCCCGG + Intronic
1060514853 9:124258954-124258976 TAGGGTCAGCCCCCCAGGCCTGG - Intronic
1060551684 9:124488417-124488439 AGCCCTGAGCCCAGCAGGCCAGG - Intronic
1060670821 9:125467715-125467737 TGACCTCAGCAGCCCAGCCCCGG - Intronic
1060731470 9:126039622-126039644 TGGTCTCAGGCCCCCAGGTCAGG - Intergenic
1060807847 9:126588662-126588684 TGCCCTCAGCTCCCCAGCCTGGG - Intergenic
1060981790 9:127796808-127796830 TGCCCTCTCACCCCCAGGACTGG + Intronic
1061135084 9:128729241-128729263 TTTCCTCAGCCCCTCGGGCCAGG + Intergenic
1061184048 9:129041771-129041793 CACCCTCTGCCCCCCAGGCCTGG - Intronic
1061215114 9:129217313-129217335 GGAACTCAGCCCCTCAGGCCTGG + Intergenic
1061453399 9:130681140-130681162 GGCCCTCAGCGCCCCCAGCCCGG - Intronic
1061490336 9:130940564-130940586 TGCCCTCAGCCACACAGCCAGGG - Intergenic
1061502831 9:131013557-131013579 GGCCCTGAGCCCCTCAGGACAGG - Intronic
1061633634 9:131890749-131890771 TGCCCACAGCCACACAGGGCTGG - Intronic
1061692145 9:132341826-132341848 TACCCACCGCCACCCAGGCCAGG + Intronic
1061743819 9:132725619-132725641 TGCCCCCAGCCCCCCAGCCTCGG - Exonic
1062024583 9:134334421-134334443 GGCCCTCTGCACACCAGGCCTGG - Intronic
1062098944 9:134718000-134718022 TGGCCGCGGCCCCCCAGCCCAGG - Intronic
1062272154 9:135714497-135714519 AGCCCCCGGCCCGCCAGGCCCGG - Intronic
1062408342 9:136408787-136408809 TGGCCCCAGCCCCCCAGGTGGGG + Intronic
1062409977 9:136418694-136418716 TATCCTCAGGCCACCAGGCCAGG + Intronic
1062502152 9:136856235-136856257 TGCCCCCCGCCCCGCTGGCCAGG + Intronic
1062551691 9:137090422-137090444 TGCCTCCAGCTCCCCAGCCCAGG - Intronic
1062564006 9:137155871-137155893 TTCGCCCAGCCACCCAGGCCTGG - Intronic
1185506386 X:634597-634619 TGCCCTCCGCTCCCCACGCAGGG + Exonic
1185599265 X:1327786-1327808 TGCTCAGAGCCCCCCAGGGCAGG - Intergenic
1186649279 X:11541347-11541369 TGCCCTAATCACCCCAGGCCAGG - Intronic
1189187287 X:39065332-39065354 TGCTCTGAGCCCACCTGGCCAGG - Intergenic
1190119781 X:47650489-47650511 GCCCCACCGCCCCCCAGGCCTGG + Exonic
1190526353 X:51332807-51332829 TGCCGTCTGCCCCCGAGCCCGGG - Intronic
1191834165 X:65446156-65446178 TGTCCTCAGGCCCCCATTCCAGG - Intronic
1195401023 X:104461485-104461507 TTCCCTCCTCCCCCCAGACCTGG + Intergenic
1195943225 X:110182300-110182322 TGCCAGCATCCACCCAGGCCAGG + Intronic
1196950979 X:120875434-120875456 TGGCCGCAGTCCCCCAGGGCGGG - Exonic
1197302872 X:124802525-124802547 AGCCCCCAGCCCCCCAGCCAAGG - Intronic
1197819407 X:130529897-130529919 TGGCCTCACCCCCTCAGCCCTGG + Intergenic
1197819439 X:130530032-130530054 TGACCTCACCCCCTCAGGCTTGG + Intergenic
1198184169 X:134237477-134237499 TGTCCTTAGAGCCCCAGGCCGGG + Intronic
1199123979 X:144091939-144091961 TGCACTCAGCTCCATAGGCCAGG - Intergenic
1199675885 X:150189028-150189050 TTCCCTCAACAGCCCAGGCCTGG + Intergenic
1200055224 X:153456707-153456729 GGCCCTCAGCCCCACAGGGAAGG + Intronic
1200163372 X:154020111-154020133 TGCCCTCTGTCCCCAACGCCGGG - Intergenic
1200402822 X:156029500-156029522 TACCCTCAGCCCGCCCGCCCGGG - Intergenic