ID: 1076697097

View in Genome Browser
Species Human (GRCh38)
Location 10:132252116-132252138
Sequence CTCTGGCCAAGAACCCGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076697093_1076697097 15 Left 1076697093 10:132252078-132252100 CCCTCAGGGCTGGACTTTGGCAC 0: 1
1: 0
2: 0
3: 21
4: 178
Right 1076697097 10:132252116-132252138 CTCTGGCCAAGAACCCGCTAGGG No data
1076697094_1076697097 14 Left 1076697094 10:132252079-132252101 CCTCAGGGCTGGACTTTGGCACT 0: 1
1: 0
2: 0
3: 19
4: 195
Right 1076697097 10:132252116-132252138 CTCTGGCCAAGAACCCGCTAGGG No data
1076697092_1076697097 16 Left 1076697092 10:132252077-132252099 CCCCTCAGGGCTGGACTTTGGCA 0: 1
1: 0
2: 2
3: 22
4: 217
Right 1076697097 10:132252116-132252138 CTCTGGCCAAGAACCCGCTAGGG No data
1076697089_1076697097 25 Left 1076697089 10:132252068-132252090 CCTGCTGGGCCCCTCAGGGCTGG No data
Right 1076697097 10:132252116-132252138 CTCTGGCCAAGAACCCGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076697097 Original CRISPR CTCTGGCCAAGAACCCGCTA GGG Intronic
No off target data available for this crispr