ID: 1076701419

View in Genome Browser
Species Human (GRCh38)
Location 10:132275201-132275223
Sequence CCCAGAGACATGGTGGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 324
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 294}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701419_1076701434 26 Left 1076701419 10:132275201-132275223 CCCGTGCCCACCATGTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 294
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701419_1076701435 27 Left 1076701419 10:132275201-132275223 CCCGTGCCCACCATGTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 294
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701419_1076701425 -5 Left 1076701419 10:132275201-132275223 CCCGTGCCCACCATGTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 294
Right 1076701425 10:132275219-132275241 CTGGGCAGTGCTGCCCCACCAGG No data
1076701419_1076701426 3 Left 1076701419 10:132275201-132275223 CCCGTGCCCACCATGTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 294
Right 1076701426 10:132275227-132275249 TGCTGCCCCACCAGGCCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701419 Original CRISPR CCCAGAGACATGGTGGGCAC GGG (reversed) Intronic
900582275 1:3415106-3415128 CCCAGGGAGGTGGTGGGCAGGGG + Intronic
901448966 1:9324712-9324734 CCCAGAGAGATTCTGGGCTCCGG - Intronic
902326169 1:15702174-15702196 CCCAGACGCAAGGTGGGCAGTGG + Intronic
902652942 1:17848486-17848508 TCAAGAGTCATGGTAGGCACCGG + Intergenic
902791925 1:18775229-18775251 CCCAGAGCATTGTTGGGCACTGG + Intergenic
903574445 1:24329790-24329812 CCCAGAGATGAAGTGGGCACTGG - Intronic
906292808 1:44631112-44631134 CCCAGTGCCATGCTGGGCTCTGG + Intronic
906484539 1:46224068-46224090 CCCAGAAAAATGGTGGGTCCAGG - Intergenic
907644703 1:56230685-56230707 CACAGAGACATGTTGGTCATTGG + Intergenic
909199291 1:72669203-72669225 TCCCTAGTCATGGTGGGCACTGG - Intergenic
909298593 1:73982991-73983013 CCCAGATACAATGGGGGCACAGG + Intergenic
912788309 1:112625676-112625698 CCCAGAAACATTGTGTTCACAGG + Intronic
914993399 1:152517598-152517620 CCCTGGGACTTGGTGGGCAGTGG + Intronic
919381504 1:196867077-196867099 CCCAGTGGCATGGGGGGCACTGG - Intronic
921193031 1:212726553-212726575 CCCAGAGACAAGGTGGACAGGGG - Intronic
1063371488 10:5525538-5525560 CCCAGGAGCATGGTGGGCGCCGG - Exonic
1063435264 10:6024448-6024470 ACCAGACACATCGTGGGCCCTGG - Intronic
1063658535 10:8015695-8015717 CCCGGAAACATGGTGGGGAAAGG + Exonic
1063971720 10:11385762-11385784 CCCCCAAACATGGTGGGGACAGG + Intergenic
1065971079 10:30806447-30806469 GCTAGAGACATGGAGGGCAGAGG + Intergenic
1066457978 10:35588047-35588069 CCCAGAGCCAGGGTGGGCCTGGG - Intergenic
1073320885 10:102615673-102615695 CCCAGTGACATGGGGGCGACTGG - Intronic
1073605206 10:104887940-104887962 CCCAGCAACATGGTGGGGGCGGG + Intronic
1075159593 10:120011634-120011656 CTCAGAGACACTGTGGGCGCTGG - Intergenic
1075557300 10:123442884-123442906 CCCAGAGACACAGTAGGCAGCGG - Intergenic
1075729386 10:124627280-124627302 CCCCGGGGCATGGAGGGCACAGG - Intronic
1076099080 10:127759380-127759402 CCCAGAGACATGGAAGGAAGAGG - Intergenic
1076200062 10:128551036-128551058 GCCAGGGGCTTGGTGGGCACTGG + Intergenic
1076201201 10:128559619-128559641 CACAGAGCCATGGTGGACATTGG - Intergenic
1076629431 10:131843278-131843300 CCCAGACACAGAGTTGGCACAGG + Intergenic
1076701419 10:132275201-132275223 CCCAGAGACATGGTGGGCACGGG - Intronic
1077138428 11:1012967-1012989 CCCAGAGTCAGGGAGGGCAGAGG - Exonic
1078615776 11:12864383-12864405 CCAAGAGAAATCATGGGCACTGG - Intronic
1079452080 11:20606060-20606082 GCCAGAGTCAAGGTGGGCACTGG - Intronic
1080624348 11:34014953-34014975 CCCAGATACTTGGTGGGCTGAGG + Intergenic
1083998597 11:66284101-66284123 CCAAGAGACAAGGTGGGCTGAGG - Exonic
1084429035 11:69101241-69101263 CCCTGAGACAAGGTGGGCATTGG - Intergenic
1084432941 11:69121757-69121779 CCCAGGGTCATGGTGGGGGCAGG - Intergenic
1084609303 11:70191936-70191958 CCCAGAGCCTGGGAGGGCACAGG + Intergenic
1084742276 11:71147394-71147416 CCCAGGGGCACGGTGGACACTGG + Intronic
1085029630 11:73263044-73263066 TTCAGAGACATGGAGGTCACTGG + Intergenic
1088735868 11:112727350-112727372 CTCACAGAGATCGTGGGCACTGG - Intergenic
1089555963 11:119316167-119316189 CCCAGGGACATGGTTGGCACTGG + Intronic
1089750458 11:120647893-120647915 CCCAGCTCCATGCTGGGCACTGG - Intronic
1089854956 11:121535471-121535493 CACAGAGCCACAGTGGGCACAGG - Intronic
1090794605 11:130123978-130124000 ACCAGACACACGGTGAGCACAGG - Intronic
1090884860 11:130866934-130866956 CACAGAGATTGGGTGGGCACGGG - Intergenic
1096489195 12:52004571-52004593 CCCAGAGTAAGGGTGGGCCCAGG - Intergenic
1097793629 12:63840908-63840930 CCCAGAGACAGGGTGCCCAGAGG - Intergenic
1097903114 12:64892742-64892764 CCCAGATACTTGGTGGGCTGAGG - Intergenic
1100623457 12:96304646-96304668 CCCTTAGACTTGGTGGGCAGGGG + Intronic
1100718324 12:97328967-97328989 CCAGGAGAGATTGTGGGCACAGG + Intergenic
1101841122 12:108328191-108328213 CCAAAAGACATGGTAGGGACTGG - Intronic
1102026791 12:109718308-109718330 CCCACCCACATGGTGAGCACCGG + Intronic
1102689220 12:114747266-114747288 CCTGGAGACATGGTGGTCACAGG + Intergenic
1104753198 12:131252835-131252857 CCCAGAGACACAGGGGGAACAGG - Intergenic
1104918831 12:132280032-132280054 CCAGGAGACCTGGTGGACACTGG - Intronic
1104962513 12:132495030-132495052 CCCAGAACCCTGGTGGGCATAGG + Intronic
1108587443 13:51882962-51882984 CCTGGGGGCATGGTGGGCACAGG - Intergenic
1108678998 13:52763378-52763400 CCTGGAGACCTGGTGGCCACTGG - Intergenic
1111597676 13:90432353-90432375 CCCAGAAACATGGTGATCATTGG - Intergenic
1113566053 13:111320382-111320404 CCCACAGGCTTGGTGGGCAAGGG + Intronic
1113848459 13:113405021-113405043 GCCTCAGACATGGTGGGCACAGG - Intergenic
1113955563 13:114098526-114098548 CCCTGAGACCTGGTGGGCTGGGG + Intronic
1114566995 14:23639962-23639984 AACAGAGTCTTGGTGGGCACAGG - Intronic
1114780544 14:25533736-25533758 CCTAGAGACTTGGAGGGCTCAGG - Intergenic
1119439588 14:74619385-74619407 CTCAAAGCCAAGGTGGGCACAGG - Intergenic
1120317883 14:82919561-82919583 CAGAGAGACATGGTGGGAAGTGG - Intergenic
1121509347 14:94500785-94500807 TCCAGAGGCAAGGTGGGCTCTGG - Intronic
1122888145 14:104719662-104719684 CCCACAAACATGGTGAGCGCTGG + Intronic
1123061363 14:105596186-105596208 CCCAGAGCCATCGGGGCCACAGG - Intergenic
1123085817 14:105717097-105717119 CCCAGAGCCATCGGGGCCACAGG - Intergenic
1202937824 14_KI270725v1_random:108458-108480 CTCAGACACATGGAGGCCACAGG + Intergenic
1123850823 15:24354764-24354786 CCAAGAAACATGATGGACACAGG - Intergenic
1124124795 15:26929539-26929561 CCCAGAGAGCTGTGGGGCACAGG - Intronic
1124373806 15:29117880-29117902 CACAGAGACAAGGAGGGCACAGG + Exonic
1127635881 15:60869267-60869289 CCCAGAGATATAGAGGGCACAGG + Intronic
1128995425 15:72291150-72291172 CCCATAGAAAGGGTGGACACAGG - Intronic
1129109114 15:73327512-73327534 CCCAGTCACAGGCTGGGCACTGG + Intronic
1130312255 15:82765868-82765890 CCCAGAGACTTTGTGGGCTGGGG + Intronic
1131168962 15:90162983-90163005 CACAGAGAAACGATGGGCACAGG - Intronic
1131493092 15:92880040-92880062 CCCAAAGAAATGGTAGTCACAGG + Intergenic
1131593705 15:93775285-93775307 TCCAGAGACATGGCAGGCAAGGG + Intergenic
1131777781 15:95821288-95821310 CCCAGAGACATTATGGCCATAGG - Intergenic
1131783907 15:95890703-95890725 TCCAGAGAGATGGTGGCCCCAGG + Intergenic
1132013929 15:98299764-98299786 CCCTCAGATTTGGTGGGCACAGG - Intergenic
1132340942 15:101078375-101078397 CCCAACGACGTGGTGGACACTGG + Intergenic
1132514449 16:359720-359742 CCCAGGCACATTGTGAGCACAGG + Intergenic
1132522617 16:398430-398452 CTCAGACACAGGGTGGGCTCTGG + Intronic
1132842802 16:1986445-1986467 CACAGAGCCATGGGGGGCAGGGG - Exonic
1133042983 16:3070467-3070489 CCAAGACACATTGTGGGTACAGG + Intronic
1133045068 16:3083402-3083424 CCAAGACACATTGGGGGCACAGG + Intergenic
1133089972 16:3396521-3396543 CCTAGAGTAATGGAGGGCACAGG - Intronic
1133209346 16:4254388-4254410 CCAAGAGGCATGGGGGGCATTGG + Intergenic
1133270873 16:4610283-4610305 CCCTGAGACCTGGGGGGCGCTGG - Intronic
1134692247 16:16198449-16198471 GCCTGCGACATGGTGAGCACTGG - Intronic
1135115274 16:19718388-19718410 GCGAGAGACACGGTGGGCACCGG - Exonic
1137374912 16:47944223-47944245 CCCAGGGAGATGGAGGCCACTGG + Intergenic
1137716190 16:50599764-50599786 CCCAGAGCCAGGCAGGGCACGGG - Intronic
1139635026 16:68253275-68253297 CCCAGAGAAATGATGGGAGCTGG - Intronic
1140158031 16:72454703-72454725 CACAGGGTCATGGTGGCCACAGG - Intergenic
1140403893 16:74694816-74694838 CCCAGATATATGGTGGGGGCTGG - Intronic
1141037722 16:80643091-80643113 CCCAGACACAAGGGGGGTACAGG + Intronic
1141558767 16:84853278-84853300 CCCAGAGACAGGATGGGCTCTGG + Intronic
1141609760 16:85174730-85174752 CCCAGTGCCAGGGTGGGCATGGG + Intronic
1141644521 16:85360164-85360186 TCCAGGGACCTGGTGGCCACCGG - Intergenic
1141658584 16:85429523-85429545 CCCAGGGACATGGGAGCCACAGG - Intergenic
1141894397 16:86949402-86949424 CCCAGAGAGATGGTGGGATGTGG - Intergenic
1143786649 17:9260695-9260717 CCCAGGCACATGGGGGACACTGG - Intronic
1144824539 17:18098419-18098441 CTCACACACAGGGTGGGCACAGG - Intronic
1147886959 17:43690782-43690804 CCCAGGGATATGCTGGCCACGGG + Intergenic
1148760680 17:49998227-49998249 GCTAGAGACAGGGTGGGCAATGG - Intergenic
1148999239 17:51740195-51740217 CCCATACACATAATGGGCACAGG - Intronic
1149549829 17:57532057-57532079 CCAGGAGTCCTGGTGGGCACTGG + Intronic
1150231047 17:63550666-63550688 TGCAGGGACATGGTGGCCACGGG - Exonic
1151257365 17:72888961-72888983 TGCAGAGACATGGTGTGCAGAGG + Intronic
1151306693 17:73267219-73267241 TCCAGGGACATGGTGTGCATTGG - Intergenic
1151731539 17:75914373-75914395 CCCAGGGGCAGGGTGGGCAGAGG - Intronic
1152043856 17:77923405-77923427 CTCAGAGAGCTGGTGGGCAGAGG + Intergenic
1152491433 17:80637250-80637272 CCCAGAGCCACGCTGGGCATGGG - Intronic
1152745784 17:82038112-82038134 GCCTGAGAGATGATGGGCACAGG - Intergenic
1153132112 18:1865987-1866009 CACAGAACCATGATGGGCACGGG + Intergenic
1155073851 18:22338448-22338470 CACAGAGACAGGGTGGGGATGGG + Intergenic
1155141701 18:23050114-23050136 GGCAGAGACATGGAGTGCACAGG - Intergenic
1155515905 18:26623850-26623872 CCTAGAGACTTGGAGGGCTCAGG + Intronic
1156470683 18:37375705-37375727 CCCAGAGGCCAGGTGGGCAGTGG - Intronic
1157169251 18:45386886-45386908 ACCAGGCACATGGTGAGCACAGG + Intronic
1157430602 18:47621355-47621377 CCCAGAGAGCTGGAGGGCATGGG + Intergenic
1157598492 18:48878272-48878294 CCCGGAGCCATGGTGGGCTCAGG + Intergenic
1157717709 18:49900374-49900396 CCCAGGCACAGGGTGGGCACAGG - Intronic
1158029841 18:52950019-52950041 ACCAGGGGCATGGTTGGCACTGG + Intronic
1161221834 19:3121514-3121536 CCCAGAGTCACTGGGGGCACGGG - Exonic
1162001002 19:7745066-7745088 CCCAGGGACAGGGGTGGCACAGG + Exonic
1162449853 19:10748172-10748194 TACAGTGACATGGTGTGCACAGG + Intronic
1162476766 19:10905120-10905142 CCCAGAGCCCTGGTGGGCAGGGG + Intronic
1162837449 19:13330175-13330197 CCAAGAGACATGGTGGGGTGGGG - Intronic
1162933295 19:13967835-13967857 CCCACAGCCATGGTGTCCACAGG - Intronic
1163107706 19:15135494-15135516 CCCAGATACATGGGAGGCAGAGG + Intergenic
1163441369 19:17324042-17324064 CCCAGAGGCAGGGTATGCACCGG - Intronic
1164543833 19:29142695-29142717 AACAGAGACAGGGTGGCCACAGG + Intergenic
1165858940 19:38896906-38896928 TGCAGACACATGCTGGGCACAGG - Intronic
1165992602 19:39825282-39825304 CTCAGAGGCATGGTGGGGAAGGG - Intergenic
1166101739 19:40575680-40575702 ACGCGTGACATGGTGGGCACCGG + Exonic
1166118130 19:40667922-40667944 GCAGGAGGCATGGTGGGCACTGG + Exonic
1166328632 19:42066188-42066210 CCCAGAGACAGGGGCGGGACTGG - Intronic
1166915909 19:46196105-46196127 TGCAGAGACATGCTGGGCCCTGG - Intergenic
1166925135 19:46261684-46261706 TGCAGAGACATGCTGGGCCCTGG + Intergenic
1167264637 19:48477609-48477631 GACAGAAACAGGGTGGGCACAGG - Intronic
1168563578 19:57403957-57403979 CACAGAGCCATGGTGGGCACAGG + Intronic
924968950 2:106289-106311 TCCAGAGACATGGTTGTCAGAGG + Intergenic
925986197 2:9217141-9217163 CCAAGGGCCTTGGTGGGCACGGG - Intronic
926488693 2:13496601-13496623 CCCTGAGATAGGGTAGGCACAGG - Intergenic
927288365 2:21379936-21379958 CCTAGAGACTTGGAGGGCTCAGG - Intergenic
927341988 2:21993064-21993086 CCTAGAGACTTGGGGGGCTCAGG - Intergenic
929121527 2:38487947-38487969 CCGAGACACATGCTGGGCATAGG - Intergenic
930013934 2:46958000-46958022 CCCAGATACATGGTGGAGCCAGG + Intronic
930742576 2:54847021-54847043 CCCAGCTACTTGGGGGGCACAGG - Intronic
932443146 2:71750892-71750914 CCCAGAGATATGATGGGCTGTGG + Intergenic
933659467 2:84915816-84915838 CCCAGAGCCCTGGTGGCCATGGG + Intergenic
933768899 2:85730388-85730410 CCCACAGGCATTGTGGACACAGG + Intergenic
934249777 2:90340387-90340409 ATCAGAGACATGGAGGCCACAGG + Intergenic
934259798 2:91463059-91463081 ATCAGAGACATGGAGGCCACAGG - Intergenic
935126431 2:100227596-100227618 CCCAGACACATGGGTGGCAGGGG + Intergenic
935625712 2:105170752-105170774 CCCAGAAACATGGTTGGAAAAGG + Intergenic
936067724 2:109344738-109344760 CCAAGGGAAAGGGTGGGCACAGG + Intronic
936568963 2:113599754-113599776 CCCAAAGAAATGGTGGGTCCTGG - Intergenic
936791411 2:116157675-116157697 CCCTGTGACAGGGTGGTCACAGG - Intergenic
936827969 2:116604519-116604541 CCCAGATACAATGTGGGTACAGG - Intergenic
937259429 2:120576178-120576200 CCCAGCAACATGGTGGGTCCTGG + Intergenic
938342770 2:130546536-130546558 CCCAGAGTGATGGTGGGGTCTGG - Intronic
938347063 2:130574186-130574208 CCCAGAGTGATGGTGGGGTCTGG + Intronic
938519501 2:132052870-132052892 CTCAGACACATGGAGGCCACAGG + Intergenic
938970027 2:136423562-136423584 CACAGAGATAAGGTGGGCAGAGG + Intergenic
940853840 2:158714531-158714553 TCCACAGACATGGTGGGGAGAGG + Intergenic
941745973 2:169087602-169087624 CTCAGAGACATGCTGGCCTCAGG - Intronic
942082153 2:172410492-172410514 CCAAGAGACATGGAGGGCTCAGG + Intergenic
943237945 2:185347019-185347041 CCTAGAGACTTGGAGGGCTCAGG + Intergenic
945333369 2:208563863-208563885 CCTAGAGACTTGGAGGGCTCAGG - Intronic
946739182 2:222785156-222785178 CTCAGAGACAAGGTGGACAGTGG + Intergenic
948173951 2:235928627-235928649 AGCAGGAACATGGTGGGCACGGG + Intronic
948336042 2:237207878-237207900 TCCAGCCACATGGTGAGCACTGG - Intergenic
948378861 2:237539634-237539656 CCCACAGACAAGGTGGCCAGTGG + Intronic
948803706 2:240444044-240444066 CCCAGAGGCCTGAGGGGCACCGG + Intronic
1169422604 20:5472013-5472035 GCCAGAGACATGCTGGGCAGTGG + Intergenic
1169426866 20:5503769-5503791 GCCAGAGACATGCTGGGCAGTGG - Intergenic
1170071617 20:12375213-12375235 CCCTGACACATGGTAGGCTCTGG - Intergenic
1172551494 20:35803968-35803990 CCCAGATACATGGAGGGCTAAGG - Intronic
1172995989 20:39070846-39070868 CCCAGAGACTTGGTAGGCTGAGG - Intergenic
1173387172 20:42599484-42599506 CCCAGAGAGATGGGGTGCAATGG + Intronic
1173408822 20:42791540-42791562 CCCATAAACATGGTGGCCAGAGG + Intronic
1173812095 20:45962235-45962257 GCCACAGGCATGGTGGGGACGGG - Intronic
1174132274 20:48354138-48354160 CTCAGAGAGATGGTGGGCTGTGG + Intergenic
1174238597 20:49114758-49114780 CCGAGAGACACGGTGGGTAAAGG - Exonic
1175540333 20:59744036-59744058 ACCACAGACAGGGTGGACACAGG + Intronic
1175738573 20:61404574-61404596 CACAGAGACAACGTGGGCAGGGG + Intronic
1178279331 21:31267256-31267278 CCCAGAGAGAAGATGGCCACAGG + Intronic
1179563870 21:42234518-42234540 CCCAGGGCCAGGGTGGGCAGAGG - Intronic
1179588401 21:42388770-42388792 CCCAAAGACATGTTGGGCTGGGG - Intronic
1181975684 22:26727673-26727695 CCGGGGGACTTGGTGGGCACTGG + Intergenic
1183616697 22:38950157-38950179 ACCTCAGCCATGGTGGGCACTGG + Intergenic
1184075153 22:42172248-42172270 CTCAGAAACCTGGAGGGCACAGG + Intronic
1184217849 22:43079240-43079262 CCCACAGACATGGGGGCCAAGGG + Intronic
1184837856 22:47034612-47034634 CCCAGAGACAGCCGGGGCACAGG - Intronic
1184881352 22:47306434-47306456 CCCAGAGACGCTGTGGCCACTGG + Intergenic
1185098522 22:48825109-48825131 CCTGGAGACATGGAGGGCAGTGG + Intronic
1185246213 22:49774712-49774734 CCCAGAGTCAGGGTGGGCCCTGG + Intronic
1203237362 22_KI270732v1_random:18022-18044 CTCAGACACATGGAGGCCACAGG - Intergenic
950655899 3:14435968-14435990 TCCAGAGGCCTGGTGGGCAAAGG - Intronic
951031772 3:17890736-17890758 TCCACAGACAGGGTGGGCTCAGG + Intronic
951602093 3:24387873-24387895 CCCAGAGACAGGATGGGACCAGG + Intronic
952188067 3:30992503-30992525 CCCAGATACAATGTGGGTACAGG + Intergenic
952341424 3:32450744-32450766 CCCGGAAACACAGTGGGCACAGG - Intronic
954330907 3:49889863-49889885 CCCAGAGACATGGAAGAGACAGG - Intronic
955772981 3:62405004-62405026 CCCAGGGACAGGGTGATCACTGG + Intronic
957327096 3:78710183-78710205 CCCAGCGACATGGGGGGCTGAGG - Intronic
958069140 3:88586708-88586730 CCCAGTGACATGGTGTCAACTGG + Intergenic
961536386 3:127573383-127573405 TCCAGACTCATGGTGGGAACAGG + Exonic
961839628 3:129697944-129697966 CCTAGAGACTTGGAGGGCTCAGG - Intronic
962035557 3:131647790-131647812 CCCAGAGACCAGGTGGGAAAGGG - Intronic
963892740 3:150653894-150653916 CTCAGAAACATGGCTGGCACTGG - Intergenic
964305894 3:155339331-155339353 CTCAGTGCCATGGTGGGCCCTGG + Intergenic
964589284 3:158342040-158342062 CCCAGATACAATGTGGGTACAGG - Intronic
966178983 3:177170718-177170740 CCCAGGTACTTGGTGGGCAGAGG - Intronic
967948725 3:194824112-194824134 CTCTGGGGCATGGTGGGCACAGG - Intergenic
968391853 4:199308-199330 ACCAGAGTCATGGTGGGGAATGG - Intergenic
968401645 4:303879-303901 TCAAGAGTCATGGTGGGGACAGG + Intronic
968590359 4:1455873-1455895 CCTAGATACAGGGTGGGTACAGG + Intergenic
968952511 4:3702295-3702317 CCCTGAGACCTGGGGGCCACGGG - Intergenic
969054702 4:4394329-4394351 TTCAGAGACATGGCAGGCACAGG + Intronic
969301644 4:6300567-6300589 CCCAGAGGCAGGGTGGTCAGAGG + Intronic
969675408 4:8611698-8611720 CACACAGACATGGTGTCCACAGG - Intronic
970273560 4:14372606-14372628 CCCAGGGACATGTTGGTCAAAGG + Intergenic
970447925 4:16139667-16139689 CCCAGAGACTGGCTGGGCAGAGG + Intergenic
975627080 4:76360711-76360733 CCAAGATACATGGAGGGTACAGG - Intronic
975718650 4:77229286-77229308 CCCAGAGGCATGGGTGGCAGTGG - Intronic
976934598 4:90614065-90614087 CACAGAGACACAGTGAGCACAGG - Intronic
978252552 4:106650165-106650187 CCTAGATACAATGTGGGCACAGG - Intergenic
979629064 4:122880125-122880147 CCCAGATACAATGTGGGTACAGG + Intronic
979859182 4:125672530-125672552 ACCAGAGAGATGGTGGGTTCAGG + Intergenic
983746485 4:171206599-171206621 TACAGAGAGTTGGTGGGCACTGG + Intergenic
984367021 4:178812793-178812815 CACACAGCCATGGTGGTCACGGG - Intergenic
985661441 5:1159044-1159066 CCCAGGGACAGGGTGGGCAGAGG - Intergenic
986625732 5:9722221-9722243 GTCAGAGACATGGTGGCCTCAGG - Intergenic
987479946 5:18440889-18440911 CCCAGAGACATGGGAGGCTGAGG - Intergenic
988579706 5:32458405-32458427 CCTAGAGACAATGGGGGCACAGG + Intergenic
988731943 5:33981136-33981158 CCTGGAGACATAGTGGGCAGGGG + Intronic
988945390 5:36191538-36191560 TCCAGAGACATGAGGGACACTGG + Intergenic
990334275 5:54756804-54756826 ACCAGAGACATGGGGAGCACGGG - Intergenic
993635133 5:90334021-90334043 CCCTGAGCCATGCTGGACACTGG + Intergenic
993737773 5:91498341-91498363 CCCAGATCCCTGGTTGGCACTGG + Intergenic
994146535 5:96401822-96401844 CCCAGAAGAATGCTGGGCACAGG + Intronic
994155645 5:96500978-96501000 CCCAGAGAAATGGTGGCCCCAGG + Intergenic
999248236 5:150166865-150166887 CCCACATACATGGTGGCCGCGGG - Exonic
999789076 5:154921342-154921364 CCAAGTGACATGGGGGGTACTGG + Exonic
1001856493 5:175015254-175015276 CCTACAGGCATGGTTGGCACAGG + Intergenic
1002576324 5:180176209-180176231 CCCAGAGAGCAGGTGGGCCCTGG + Intronic
1002594102 5:180311156-180311178 CCCAGAGACAGAGTGGACGCTGG - Intronic
1002820481 6:720013-720035 CCCAGAGACACGCTGGGAAGAGG + Intergenic
1005575006 6:27182391-27182413 CCCAAAAACATGGAGGCCACCGG + Intergenic
1007038864 6:38702960-38702982 CCCAGTACCAAGGTGGGCACAGG - Exonic
1007650811 6:43419884-43419906 CCAAGAGGAATGGTAGGCACAGG + Intergenic
1007866286 6:44973486-44973508 CCTAGAGACTTGGAGGGCTCAGG - Intronic
1010630108 6:78189202-78189224 CCCAGATACAATGTGGGTACAGG + Intergenic
1012849082 6:104425320-104425342 GCCATAGACATGTTGGGCTCTGG - Intergenic
1013717282 6:112976640-112976662 CCTAGATACAATGTGGGCACAGG - Intergenic
1014726531 6:124978352-124978374 CGCAGAGCCACGGTGGGCACAGG - Intronic
1018408408 6:163513888-163513910 CCCTGAGCCCTGGTGTGCACAGG + Intronic
1018507196 6:164484126-164484148 CCTAGAGACTTGGAGGGCTCAGG - Intergenic
1019410489 7:904600-904622 CCCTGAGCCGTGGCGGGCACTGG - Intronic
1019506562 7:1394335-1394357 CTCAGAGAGATGGGGGGCATTGG + Intergenic
1020432466 7:8127965-8127987 CCCAGGGCCATAGTGGGCACTGG + Exonic
1020837885 7:13177243-13177265 CCCAGGTACAAGGTGGCCACAGG + Intergenic
1020934379 7:14442794-14442816 CCCAGACACATGGGAGGCAGAGG - Intronic
1021944767 7:25715885-25715907 CCCAGAATCATGGTGGGTAGAGG + Intergenic
1022584220 7:31590182-31590204 CCCAGATACTTGGTAGGCAGAGG - Intronic
1023064585 7:36364780-36364802 CGCAGTGAAATGCTGGGCACAGG + Intronic
1024220373 7:47282180-47282202 CTCAGTTACATGGTGGACACAGG - Intronic
1026420869 7:70235765-70235787 CCCAGCTACATGGTGGGCTGAGG - Intronic
1026494933 7:70893938-70893960 CCAAGAGCCACGGTGGCCACTGG + Intergenic
1028158735 7:87462006-87462028 CTAAGAGACCTTGTGGGCACTGG - Intronic
1029544030 7:101201037-101201059 CCCAGAGACATCTGGGGCTCTGG - Intergenic
1032792929 7:135255715-135255737 CCCACAGACCTGGGGGGCAAGGG - Intronic
1034252397 7:149702822-149702844 CGCAGAGACATGGTTGGCAGGGG - Intergenic
1035590551 8:809898-809920 CCCAGAAGCATGGTGTGCTCTGG + Intergenic
1038448410 8:27620699-27620721 CACAGAGACAAGGAGGCCACTGG + Intergenic
1040014828 8:42691680-42691702 CCCGGAGATATGGGGGGCACTGG - Intergenic
1040512178 8:48105416-48105438 GCCAGAGACATGGAGGACAAAGG - Intergenic
1041908576 8:63062077-63062099 CCCAGATACTTGGTGGGCTGAGG + Intronic
1044394336 8:91692397-91692419 CCCATAAGCATGGTGGCCACCGG + Intergenic
1044431382 8:92111698-92111720 TGCAGAGACATGGAGAGCACTGG - Intergenic
1047888722 8:129282799-129282821 CCCATAGACTTGCTTGGCACAGG - Intergenic
1048463149 8:134639443-134639465 CCCTGGGGCATGGTGGGCAGGGG + Intronic
1048869576 8:138785945-138785967 CCCAGAGACAAGGTGAACAGCGG + Intronic
1048972360 8:139652372-139652394 CCCAGAGCCATGATGGGCTCAGG - Intronic
1049101249 8:140580497-140580519 CCCAGACTCATGATGGGCTCAGG + Intronic
1049348730 8:142152801-142152823 CCCAGAGGCATGGCCAGCACCGG + Intergenic
1049586665 8:143435593-143435615 CCCAGAGGCAGGATGGGCACAGG + Intergenic
1049633570 8:143673182-143673204 CCCAGCTACGTGGTGGGCTCAGG + Intergenic
1049673725 8:143880606-143880628 CCCAGGGGCAGCGTGGGCACTGG - Intergenic
1050123746 9:2335156-2335178 CCCAGAGCCATGCTGTGAACAGG - Intergenic
1052014350 9:23447466-23447488 ACCTGAGAAATGCTGGGCACTGG - Intergenic
1053434800 9:38067876-38067898 TCCAGAGCCACGGTGCGCACGGG - Intronic
1055434674 9:76280618-76280640 CCCAGCTACATGGTGGGCTGAGG + Intronic
1057076379 9:92140369-92140391 CCCAGAGCCCTGGTGAGCAAAGG - Intergenic
1057205225 9:93167928-93167950 CACAGTGACATGGAGGGCACCGG + Intergenic
1058380241 9:104369935-104369957 CCCAGAGACTTGATGGGTAACGG + Intergenic
1060330498 9:122664507-122664529 CCCAGAGACATGTTTGTCAGAGG + Intergenic
1060401064 9:123349891-123349913 CCCAGAGACAGTGAGGCCACTGG + Intergenic
1060409701 9:123391993-123392015 CGCGGAGACAAGGTGGGCAGAGG - Intronic
1060733826 9:126053845-126053867 CCAAGGGGCATGGTGGGTACAGG - Intergenic
1061194033 9:129097897-129097919 TCCAGCCCCATGGTGGGCACGGG - Intronic
1061857341 9:133449520-133449542 CCCAGAGACAGTGGGGGCAGGGG - Intronic
1062047102 9:134429406-134429428 CCCAGAGGCAGGGCTGGCACAGG - Intronic
1062171979 9:135139871-135139893 CCCAGAAGCATGGAGGGGACTGG - Intergenic
1062215305 9:135385902-135385924 CTCAGACGCAGGGTGGGCACGGG - Intergenic
1062506909 9:136882284-136882306 CACAGAGCCCTGCTGGGCACAGG + Intronic
1062566792 9:137167198-137167220 CCCAGAGACCAGGTGGGAGCTGG - Intronic
1203581389 Un_KI270746v1:9178-9200 CTCAGACACATGGAGGCCACAGG - Intergenic
1188182163 X:27069678-27069700 CCCAGCTACATGGTAGGCTCAGG + Intergenic
1190116452 X:47628798-47628820 CCCAGATACACCGTGGGCATGGG - Intronic
1190938895 X:55021141-55021163 CTCAGAGAAATGTTGGGCAAAGG + Exonic
1192539079 X:71953066-71953088 CCCAGAGACAGGCTGGGAGCTGG - Intergenic
1199879166 X:151959250-151959272 CACATAGACATAGTGGCCACTGG - Intronic
1200157449 X:153984742-153984764 CTCAGAGACAGGGTGGGGGCAGG + Intergenic