ID: 1076701421

View in Genome Browser
Species Human (GRCh38)
Location 10:132275202-132275224
Sequence GCCCAGAGACATGGTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 349
Summary {0: 1, 1: 0, 2: 9, 3: 36, 4: 303}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701421_1076701435 26 Left 1076701421 10:132275202-132275224 CCGTGCCCACCATGTCTCTGGGC 0: 1
1: 0
2: 9
3: 36
4: 303
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701421_1076701425 -6 Left 1076701421 10:132275202-132275224 CCGTGCCCACCATGTCTCTGGGC 0: 1
1: 0
2: 9
3: 36
4: 303
Right 1076701425 10:132275219-132275241 CTGGGCAGTGCTGCCCCACCAGG No data
1076701421_1076701426 2 Left 1076701421 10:132275202-132275224 CCGTGCCCACCATGTCTCTGGGC 0: 1
1: 0
2: 9
3: 36
4: 303
Right 1076701426 10:132275227-132275249 TGCTGCCCCACCAGGCCCCATGG No data
1076701421_1076701434 25 Left 1076701421 10:132275202-132275224 CCGTGCCCACCATGTCTCTGGGC 0: 1
1: 0
2: 9
3: 36
4: 303
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701421 Original CRISPR GCCCAGAGACATGGTGGGCA CGG (reversed) Intronic
900582273 1:3415105-3415127 CCCCAGGGAGGTGGTGGGCAGGG + Intronic
900949549 1:5850607-5850629 GCCCAGAGACCTGGGGGCCTTGG - Intergenic
901207396 1:7504857-7504879 GCCCAGTGAGGTGGTGGGCATGG - Intronic
902090999 1:13903173-13903195 GCCCAGAGAGATGGGTGGCTGGG - Intergenic
902369391 1:15996150-15996172 GCCCAGATATCTGCTGGGCATGG + Intergenic
902795979 1:18800532-18800554 TCCCAGAGACAGGGGTGGCATGG + Intergenic
903407234 1:23108064-23108086 GCCAAGAGACCTGGTGGTCTTGG - Intronic
903981631 1:27192861-27192883 GCACAGAGACCTCTTGGGCAGGG + Intergenic
904259995 1:29282960-29282982 GGCCAGGGTCATGGTGGGCGTGG + Intronic
904358137 1:29954695-29954717 GAACAGAGACAGGGTGGGAAGGG - Intergenic
905530875 1:38677775-38677797 GCCCAGACACTTTGTAGGCATGG + Intergenic
906149503 1:43579351-43579373 GCCCAGAGCCATGGTGGTTCTGG - Intronic
906156612 1:43617666-43617688 GCACTGAGGCATGGTGGGCTGGG + Intronic
907246428 1:53112075-53112097 GCCCAGACTCAGGGTGGGAAGGG - Intronic
907400567 1:54222486-54222508 TCCCAGAGTCACGGTGGGCGTGG + Intronic
907441574 1:54481760-54481782 GGGCAGAGACAGGGTGGTCAAGG + Intergenic
908830905 1:68177437-68177459 GCCCAGAAACATAGGTGGCAGGG - Intronic
908852250 1:68387467-68387489 GCGTAGAGACATGGAGGGAAGGG - Intergenic
915082362 1:153360875-153360897 GGCCACAGTCATGGTGGCCACGG + Exonic
915321991 1:155061347-155061369 GCAGAGAGACAGAGTGGGCAGGG - Intronic
916856413 1:168754910-168754932 AACCAAAGACATGATGGGCAAGG + Intergenic
917283001 1:173397012-173397034 TGCCAAAGACAAGGTGGGCATGG + Intergenic
917567592 1:176229336-176229358 CCCCAGAGCCATTGTGGGCCAGG - Intergenic
919513365 1:198493691-198493713 GCCCACAGATGTGGTGAGCAAGG + Intergenic
919797183 1:201327975-201327997 GCCCAAAGACAGGAGGGGCAGGG + Intronic
919876188 1:201870634-201870656 GCCCAGTGGCATGATGAGCAGGG + Exonic
921165522 1:212504111-212504133 GCCCAGAGCCAGTGTGGGCAGGG - Intergenic
921193033 1:212726554-212726576 GCCCAGAGACAAGGTGGACAGGG - Intronic
922791914 1:228315625-228315647 GCCCAGTGCCAAAGTGGGCAGGG + Intronic
923788766 1:237093303-237093325 GCCCATAGTGATGGTGGGCTAGG + Intronic
1063224048 10:3998068-3998090 TCCCTCAGACATGGTGGTCATGG + Intergenic
1066457980 10:35588048-35588070 GCCCAGAGCCAGGGTGGGCCTGG - Intergenic
1067565018 10:47330210-47330232 GCCCAGTGACATGGAGGCCAGGG - Intergenic
1069570714 10:69492871-69492893 GCAGAGGGACATGGTGGGCCAGG + Intronic
1069690800 10:70350673-70350695 GCCCTGTGACTTGGTTGGCAGGG - Intronic
1069956804 10:72057030-72057052 GCCCAGGGAGGGGGTGGGCAGGG + Intergenic
1070770129 10:79077413-79077435 GCCCAGAGAGGTGGTGGGATTGG + Intronic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1074495637 10:113977930-113977952 GCCCAGAGAAAGGATGGGAAAGG - Intergenic
1074527390 10:114274209-114274231 CCACAGAGACTTGGTGGGCATGG + Intronic
1074546296 10:114404373-114404395 GCCCAGCGACGCGGAGGGCAGGG - Intronic
1076100527 10:127774155-127774177 GTCCAGAGACAGGCTGTGCAGGG - Intergenic
1076645112 10:131948211-131948233 GCCCAGACACAGCGTGGTCATGG + Intronic
1076701421 10:132275202-132275224 GCCCAGAGACATGGTGGGCACGG - Intronic
1077285848 11:1765433-1765455 GCCTAGAAACAGGGTTGGCAGGG - Intergenic
1077391829 11:2303867-2303889 CCCCACAGGCATGGAGGGCAGGG + Intronic
1077479700 11:2807822-2807844 GCCAGGAGGCATGGTGGGCAGGG - Intronic
1077499110 11:2901314-2901336 GGCCAAAGTCCTGGTGGGCAGGG - Intronic
1078748643 11:14139214-14139236 GTCCAGAGACAAGAAGGGCATGG - Intronic
1080682609 11:34490402-34490424 GCCCAGAGACTGAGTGAGCAAGG - Intronic
1080727198 11:34910186-34910208 GCCCAAAGAAATGGGTGGCAGGG + Intronic
1081962586 11:47149214-47149236 GCCCGGAGGCATGGTCCGCAAGG + Intronic
1082663187 11:55940560-55940582 TCCAAGAGACATGGAGGGCAAGG + Intergenic
1083184278 11:61008321-61008343 GACCAGAGACCTGGTGGGCGGGG - Intronic
1083264711 11:61541390-61541412 GTCCAGAGAGATGCTGGGGAGGG + Intronic
1084170080 11:67396811-67396833 GCCCAGGGACAGGCTGGGCTGGG - Intronic
1084431837 11:69115639-69115661 GTCCAGAGAGAGGGAGGGCAAGG + Intergenic
1084684766 11:70687033-70687055 ACCCTGAGACAGGCTGGGCAGGG - Intronic
1084783680 11:71429192-71429214 GCCCAGGGAGGTGGTGGGCATGG + Intronic
1084945322 11:72635043-72635065 GCCCAGAGACTTCGAGGGCTGGG + Intronic
1084986287 11:72875750-72875772 GCCCAGAATCATGGTGGGAGTGG - Intronic
1085053434 11:73391175-73391197 GCCCAGGAACATGGTTGACATGG - Exonic
1085197468 11:74681303-74681325 GCCCAGAGGCCTGGTGGAAATGG + Intergenic
1085460000 11:76687865-76687887 GTTCTGAGACAGGGTGGGCAGGG + Intergenic
1086608507 11:88725565-88725587 GTCCAGAGGCATGGGGGTCAGGG - Intronic
1087839689 11:102908596-102908618 GCGTAGAGACATGGAGGGAAGGG + Intergenic
1089383814 11:118055193-118055215 TACCAGAGACATGGGAGGCAGGG - Intergenic
1089659084 11:119974261-119974283 GCCCAGCCACATGTTGGCCATGG - Intergenic
1089730932 11:120518262-120518284 GCCGAGAGTCATGGAGGCCAGGG - Intronic
1090506653 11:127321923-127321945 GGCAAGAGAAAGGGTGGGCAGGG + Intergenic
1093339044 12:17949373-17949395 GCCAGGAGACAGGGTGGCCAAGG - Intergenic
1096524029 12:52200146-52200168 TCCCTGAGACATGGTGGGCAAGG - Intergenic
1096770734 12:53934457-53934479 GCCCAGAGAAGTGGAGGGAACGG + Intergenic
1097816773 12:64083005-64083027 GCCCAGAGAAAAGCTGAGCATGG + Intronic
1098284396 12:68893221-68893243 TCCCAGAGACAGGGTGTGTATGG - Intronic
1099674192 12:85736437-85736459 GGCCAGAGTGATGGTAGGCATGG - Intergenic
1100623455 12:96304645-96304667 TCCCTTAGACTTGGTGGGCAGGG + Intronic
1101781864 12:107844651-107844673 GCCCTGGGGCATGGCGGGCAGGG + Intergenic
1101967229 12:109290114-109290136 GCTCAGGGACAAGGTAGGCAGGG - Intronic
1102189569 12:110976783-110976805 GCTCAGAGGCAGGGTGGGCTTGG + Intergenic
1102519378 12:113469281-113469303 GCCCAGCGACCTGGTGCGCAAGG - Exonic
1102591206 12:113958151-113958173 GGCCATGGACACGGTGGGCATGG - Intronic
1102924344 12:116815486-116815508 GACCAGAGGCAAGGAGGGCAGGG - Intronic
1103658103 12:122490925-122490947 GCCAAGAGACAGGGTAGGAAGGG - Intronic
1103944339 12:124517845-124517867 GCTCAGCGGGATGGTGGGCAGGG - Intronic
1104763528 12:131312438-131312460 GCCCAGCACCACGGTGGGCACGG + Intergenic
1104815974 12:131645639-131645661 GCCCAGCACCACGGTGGGCACGG - Intergenic
1105331557 13:19421365-19421387 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1105880227 13:24599185-24599207 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1105919605 13:24949681-24949703 GCCCTGAGCCATGGTGGGCACGG - Intergenic
1107402479 13:40083037-40083059 GCCCAGAAATATGGAGTGCAGGG + Intergenic
1107485254 13:40820522-40820544 GCCCCGAGCCATGGTGGGCATGG - Intergenic
1109037868 13:57288593-57288615 GACCAGAGACTAGGTGGGCAGGG + Intergenic
1112042825 13:95564868-95564890 TCCCAGATACGTGGTGGGAAAGG - Intronic
1112509500 13:99997376-99997398 GCCCTGAGTCAAGGTGGGCGGGG + Intergenic
1113566051 13:111320381-111320403 GCCCACAGGCTTGGTGGGCAAGG + Intronic
1113955561 13:114098525-114098547 GCCCTGAGACCTGGTGGGCTGGG + Intronic
1116436267 14:44897770-44897792 GCCCAGGGCCAGGGTGGGCGTGG + Intronic
1117220517 14:53599980-53600002 GCACAGAGAGATGGTGGACATGG - Intergenic
1119926249 14:78497063-78497085 GCCCAGTGTCATGGTGGGTGAGG - Intronic
1121011700 14:90523779-90523801 GCCCACAGGCATGGTGGTCCAGG + Intergenic
1122398907 14:101455552-101455574 GCCCAGAGACAGTGGGGGAAAGG + Intergenic
1122818551 14:104327737-104327759 GAGCAGAGACATGGTGAGGAAGG - Intergenic
1202904647 14_GL000194v1_random:61086-61108 ACCCAGAGATAGGGAGGGCAGGG + Intergenic
1125549817 15:40537027-40537049 GCCAGGAGACGTGGTGGGCCTGG + Intronic
1127321262 15:57848682-57848704 GCATAGAGACAAGGTGGGCCAGG - Intergenic
1127957930 15:63869217-63869239 GCCCAGAGACCTAGAGGTCATGG - Intergenic
1128268708 15:66290335-66290357 GCCCAGAGAAAAAGAGGGCATGG + Intergenic
1128565812 15:68699865-68699887 GCTCAGGGCCATGGTGGGCTGGG + Intronic
1129161628 15:73751242-73751264 GCCCAGGGCCAGGGTGGGCTGGG - Exonic
1129462481 15:75706550-75706572 CCCCACAGAGATGGAGGGCAGGG + Intronic
1129591464 15:76918651-76918673 GCTCAGGGGCATGGTGGGCAGGG + Intergenic
1129722383 15:77884864-77884886 CCCCACAGAGATGGAGGGCAGGG - Intergenic
1129910250 15:79220796-79220818 TCCCAGAGAGATGGTTGGCGTGG - Intergenic
1129968600 15:79758107-79758129 GGCCAGCCACAGGGTGGGCATGG + Intergenic
1130312253 15:82765867-82765889 TCCCAGAGACTTTGTGGGCTGGG + Intronic
1131592999 15:93769310-93769332 GCCCAGGGGAAGGGTGGGCAGGG + Intergenic
1131593704 15:93775284-93775306 CTCCAGAGACATGGCAGGCAAGG + Intergenic
1132670381 16:1100050-1100072 GCCCAGAGACCTGAAGGGCTTGG + Intergenic
1132678326 16:1129842-1129864 GCCCCGGGGCATGGTGGGCGAGG - Intergenic
1132842803 16:1986446-1986468 GCACAGAGCCATGGGGGGCAGGG - Exonic
1133225646 16:4339090-4339112 GCCCAGTGGCAAGGTGGGCCGGG - Exonic
1133766873 16:8844315-8844337 GCGTAGAGACATGGAGGGAAGGG + Intronic
1134102155 16:11460091-11460113 GCCCAGGGACTGGGTGGGCAGGG - Intronic
1134346706 16:13398224-13398246 GCCCACAGACAAGGTGAGGATGG - Intergenic
1134398018 16:13883173-13883195 CTTCAGAGACATGGAGGGCAGGG - Intergenic
1136135990 16:28257247-28257269 GCTCAGAGGCATGGAAGGCAGGG - Intergenic
1137557664 16:49482948-49482970 GCCTGGAGACAGGGTGGCCAGGG + Intergenic
1137698431 16:50478494-50478516 GGGCAGAGACAGGGTGGGGAAGG + Intergenic
1137716192 16:50599765-50599787 GCCCAGAGCCAGGCAGGGCACGG - Intronic
1138179819 16:54933493-54933515 GGCCCGGGACACGGTGGGCATGG - Exonic
1138482231 16:57311054-57311076 AGCCAGAGACACGGTGGGCAGGG + Intergenic
1139039387 16:62983664-62983686 GCATAGAGACATGGAGGGAAGGG + Intergenic
1141127821 16:81413656-81413678 GCCCAGAGACTTGCTGTGCGTGG + Intergenic
1141609758 16:85174729-85174751 ACCCAGTGCCAGGGTGGGCATGG + Intronic
1141618019 16:85221135-85221157 GCCCAGAGGCAGGGAGGCCAGGG + Intergenic
1142597698 17:1037579-1037601 ACCCAGGGACAGAGTGGGCAGGG + Intronic
1143406035 17:6677736-6677758 GCCCAGAGACCTCGTGGACAGGG - Intergenic
1144623060 17:16830659-16830681 GCCCAGAGACCTGGAGGGACAGG - Intergenic
1144711903 17:17406688-17406710 GCCCAGAGATCTGGGGGGGATGG - Intergenic
1144883370 17:18442057-18442079 GCCCAGAGACCTGGAGGGACAGG + Intergenic
1145148859 17:20502329-20502351 GCCCAGAGACCTGGAGGGACAGG - Intergenic
1145883766 17:28369208-28369230 TCCCAGGGACAGGGTGGACAGGG - Intronic
1146508460 17:33425630-33425652 ACACAGAGAGATGGTGGTCAGGG + Intronic
1147177002 17:38662155-38662177 GCCTGGAGACAGGCTGGGCACGG - Intergenic
1147606556 17:41777050-41777072 GCACAGAGACCTGTCGGGCAAGG + Intronic
1148565953 17:48633219-48633241 GCCCTGGGACATTTTGGGCAGGG - Intronic
1148748822 17:49932879-49932901 GCCCAAGGACATGGTGAGTAAGG + Intergenic
1148809084 17:50279012-50279034 GGCCAGAGGCAAGGTGGGGATGG - Intronic
1149646547 17:58245507-58245529 GCCCCAAGACAGGGTGGGGAGGG - Intronic
1150125571 17:62632517-62632539 GACCAGAGGCATGGGGGGCCGGG - Intronic
1150220913 17:63495438-63495460 GCCAGGAGGCAAGGTGGGCATGG - Intronic
1150231048 17:63550667-63550689 GTGCAGGGACATGGTGGCCACGG - Exonic
1151231208 17:72686445-72686467 GCCAAGAGCCATGCTGGGTAAGG - Intronic
1151569907 17:74921025-74921047 GCCCAGAGCGCTGGTGGGCCAGG + Intronic
1151761260 17:76104400-76104422 GGCCAGAGGCAGGGTGGGCAGGG - Intronic
1152040706 17:77900839-77900861 GCACAGAGCCAGTGTGGGCATGG - Intergenic
1152491435 17:80637251-80637273 ACCCAGAGCCACGCTGGGCATGG - Intronic
1152709448 17:81863510-81863532 GGCCTGAGACAAGCTGGGCATGG + Intergenic
1153132111 18:1865986-1866008 GCACAGAACCATGATGGGCACGG + Intergenic
1153137552 18:1934052-1934074 GCCCATGGACATAGTGGCCATGG - Intergenic
1155073850 18:22338447-22338469 GCACAGAGACAGGGTGGGGATGG + Intergenic
1157430600 18:47621354-47621376 CCCCAGAGAGCTGGAGGGCATGG + Intergenic
1160912065 19:1479072-1479094 GCCCAAAAACACGGTGGCCAAGG + Exonic
1161221836 19:3121515-3121537 GCCCAGAGTCACTGGGGGCACGG - Exonic
1161425633 19:4201273-4201295 GGTCACAGGCATGGTGGGCAGGG + Intronic
1161498747 19:4601592-4601614 GGCCAGAGACAGGGAGGGCCTGG + Intergenic
1161835035 19:6640182-6640204 GCCTAAAGACATGGTGAGCAAGG + Intergenic
1162476764 19:10905119-10905141 GCCCAGAGCCCTGGTGGGCAGGG + Intronic
1162750395 19:12825970-12825992 GTCCAGAGACGTGGGGGGCGTGG + Intronic
1162837451 19:13330176-13330198 CCCAAGAGACATGGTGGGGTGGG - Intronic
1164792846 19:31002729-31002751 GCCCAGAGTCATGGGTGGGATGG - Intergenic
1164830577 19:31317175-31317197 GCCCAGAGAGCTGGAGGGGAGGG - Intronic
1164856498 19:31528748-31528770 GCCCAGAGACATGGTGGATGTGG - Intergenic
1165935293 19:39385168-39385190 GCACAGAAACATGGAGGGCCGGG - Intronic
1165992603 19:39825283-39825305 CCTCAGAGGCATGGTGGGGAAGG - Intergenic
1166213017 19:41319544-41319566 GAGGAGAGACAGGGTGGGCATGG - Intronic
1166570507 19:43793326-43793348 TCCCTGAGGCATGGTGGCCAAGG - Intergenic
1166783335 19:45353411-45353433 GCCCAGAGACATGGTGATGTGGG - Intronic
1167136365 19:47618602-47618624 GCAGAGGGACAGGGTGGGCATGG - Intronic
1168179861 19:54654602-54654624 GGGCAGAGACAAGGTGGGAAAGG - Intronic
925911906 2:8579192-8579214 GCCCAGGGGCCTGGTGGGCCAGG - Intergenic
926061136 2:9805927-9805949 GCCCAGAGACAAGGGGGGTCTGG - Intergenic
927839859 2:26433722-26433744 GATCAGAGAAGTGGTGGGCAGGG + Intronic
928094861 2:28398341-28398363 GCCGAGAGACCAGGTGGGCCAGG - Intronic
928111658 2:28515354-28515376 GGCCAGGGAAGTGGTGGGCAGGG - Intronic
928280388 2:29941136-29941158 GCCCAGCAACATGGAGGGAAAGG + Intergenic
928928402 2:36600243-36600265 GCGTAGAGACATGGAGGGAAGGG - Intronic
930032776 2:47068665-47068687 GCCCAGGGATAAGGTGGGTAGGG - Intronic
932058197 2:68467721-68467743 GCCCCCGGACATGGCGGGCAAGG - Exonic
932794052 2:74679975-74679997 GGCTAGAGACAAGGTGGGCCTGG + Exonic
933659465 2:84915815-84915837 GCCCAGAGCCCTGGTGGCCATGG + Intergenic
934056274 2:88253856-88253878 GCAAAGAGTCAGGGTGGGCAAGG - Intergenic
934687550 2:96332967-96332989 GCCCAGAGAGACACTGGGCATGG + Intergenic
935126429 2:100227595-100227617 ACCCAGACACATGGGTGGCAGGG + Intergenic
935618506 2:105109265-105109287 GCCCAGAGCCCTGGAGGGTACGG - Intergenic
936265849 2:111005899-111005921 GCTCTGAGACATTGTGGGTAGGG + Intronic
939755058 2:146099999-146100021 TGCCAAAGACAAGGTGGGCATGG + Intergenic
939832245 2:147087178-147087200 GCCCACATAGAAGGTGGGCATGG + Intergenic
941376478 2:164737359-164737381 GCTCAGAGCCATGGGGGACATGG + Intronic
942267233 2:174240970-174240992 GCCCAGAGACATGGGGAGAGGGG - Intronic
942937983 2:181581603-181581625 TGACAGAAACATGGTGGGCAGGG + Intronic
945308240 2:208280913-208280935 CGCCAAAGACAAGGTGGGCATGG - Intronic
945987861 2:216369963-216369985 CCCCCGAGAAGTGGTGGGCAGGG - Exonic
946223619 2:218249995-218250017 GCCCAGATACATGGAGGACCAGG - Intronic
946360735 2:219218143-219218165 GCCCACAGTGGTGGTGGGCAAGG - Exonic
946445935 2:219740035-219740057 GCCCAGAGAGCTGGGGGCCAGGG + Intergenic
947836575 2:233180198-233180220 GCCCAGACTCATGGTGGGAGGGG + Intronic
948040916 2:234900840-234900862 GCCCAGGGCGAGGGTGGGCAGGG - Intergenic
948605913 2:239134551-239134573 GCCCAGCGTGATGTTGGGCAAGG + Exonic
948800550 2:240431493-240431515 GCCAAGAGTCAGGGTGGGGAGGG + Intergenic
1169061575 20:2664125-2664147 GCCCCGGGACATGTCGGGCAGGG - Intronic
1170567899 20:17617019-17617041 GCCCAGAGGCTTGGTGGCCTTGG - Intronic
1171461181 20:25298881-25298903 GCCCAGATGCATGGTGGGTGTGG - Intronic
1172205004 20:33157047-33157069 GCCCAGAGAGAGGGTGGGGCTGG - Intergenic
1172872289 20:38143291-38143313 GCCCAGAGACATGAAGGGACTGG - Intronic
1173812096 20:45962236-45962258 GGCCACAGGCATGGTGGGGACGG - Intronic
1175738572 20:61404573-61404595 GCACAGAGACAACGTGGGCAGGG + Intronic
1176624017 21:9075853-9075875 ACCCAGAGATAGGGAGGGCAGGG + Intergenic
1176741443 21:10607225-10607247 GCCCTGAGCCATGGTGGGCACGG + Intergenic
1177119406 21:17122669-17122691 GACTAGAGACATGGAGGGAAGGG - Intergenic
1177726226 21:24971601-24971623 GCCTATAGACATGGAGGTCATGG + Intergenic
1179588403 21:42388771-42388793 GCCCAAAGACATGTTGGGCTGGG - Intronic
1180210936 21:46295315-46295337 GCCTGGAGACATGGAGGACAAGG - Intronic
1182422049 22:30253454-30253476 GCCAAGAGTCAGGGTGGCCAGGG - Intergenic
1183482098 22:38070762-38070784 GCCCAGGGCCATGCTGGGGAGGG - Intronic
1183977730 22:41523055-41523077 GCCCAGAGGCCTGTTGGGCCGGG + Intronic
1184217847 22:43079239-43079261 ACCCACAGACATGGGGGCCAAGG + Intronic
1184272769 22:43394064-43394086 GACCAGAAACATGGTGGGTGTGG + Intergenic
1184909416 22:47517274-47517296 GCCCAGAGTCAGTGTGGGAAGGG + Intergenic
1185066999 22:48637434-48637456 GCCAAGAGACAAGGTGAGAAGGG - Intronic
950128926 3:10528404-10528426 GCCCAGAGGCAAGGTGGGTGGGG - Intronic
950178590 3:10894628-10894650 TCCCAGGGACTGGGTGGGCAGGG + Intronic
950868763 3:16211136-16211158 GCCCGGAGAGGTGGTGGCCATGG + Exonic
952836792 3:37609650-37609672 GCTCACAGACATTGTGGGCAAGG + Intronic
954269147 3:49493852-49493874 GACCAGTGAAATGGTGGGCCAGG - Intronic
954671686 3:52294417-52294439 GCCCAGAGCCCAGGTGGGGAAGG - Intergenic
954769966 3:52958298-52958320 GCCAAGAAACAGGCTGGGCAGGG + Intronic
956559186 3:70554919-70554941 GCCCAGAGACAAGGTGGGAGGGG - Intergenic
956839079 3:73120552-73120574 GACCAGAGTCATGGTTGGAAGGG + Intergenic
957759187 3:84533021-84533043 GCCTATAGGCCTGGTGGGCAGGG + Intergenic
958261202 3:91383215-91383237 GTCAGGAGACATGGTGGTCAGGG + Intergenic
960988699 3:123296602-123296624 GTCCAGAGACAGGGTCAGCATGG - Intronic
961364170 3:126389095-126389117 CCACAGAGATATGTTGGGCAGGG - Intergenic
961753527 3:129112372-129112394 GGCCATAAAAATGGTGGGCATGG + Intronic
962035559 3:131647791-131647813 GCCCAGAGACCAGGTGGGAAAGG - Intronic
965582987 3:170289402-170289424 CTCCAGAGACATTCTGGGCATGG - Intronic
966232998 3:177670340-177670362 GCATAGAGACATGGAGGGAAGGG + Intergenic
967060378 3:185866927-185866949 GCTCAGAGTCATGCAGGGCAAGG + Intergenic
968289464 3:197527447-197527469 GCCCAGTGCCCTGGTGGGCTGGG - Intronic
969209351 4:5674711-5674733 GCCCCGAGAGATGGTTAGCAGGG + Intronic
970200436 4:13599454-13599476 GCCCAGAGACAGGGACAGCAGGG - Exonic
970353504 4:15229584-15229606 GCCTAGAGGCATTGTGGACAAGG - Intergenic
974552505 4:63396423-63396445 GCACAGAGCCATGGCAGGCATGG + Intergenic
977978572 4:103296111-103296133 GGACATAGGCATGGTGGGCAAGG + Intergenic
979678397 4:123434246-123434268 GCACACAGCCATGGCGGGCAGGG - Intergenic
980253555 4:130348957-130348979 GCCCAGTAACTTGGTGAGCAAGG + Intergenic
982107318 4:152022284-152022306 GCCCAGCCACATGATGGGCATGG - Intergenic
982455265 4:155602345-155602367 GGCCAGAGGTATGGTGGGCCAGG - Intergenic
982843685 4:160223711-160223733 GGCCAGGGACAAGATGGGCAGGG + Intergenic
984227253 4:177050361-177050383 GGCCAGAGACAGGGAGGGAATGG - Intergenic
986812861 5:11378321-11378343 GCCCAGAGGCATGGCCAGCAGGG + Intronic
987008885 5:13739707-13739729 GCACACAGACATGGAGGGAAAGG + Intronic
988731941 5:33981135-33981157 ACCTGGAGACATAGTGGGCAGGG + Intronic
989165873 5:38433172-38433194 GCTCAGAGACAGGTAGGGCAGGG + Intronic
990175060 5:53098794-53098816 GACGAGAGACATCATGGGCAAGG + Intronic
990334276 5:54756805-54756827 GACCAGAGACATGGGGAGCACGG - Intergenic
991501163 5:67278945-67278967 GCCCAGAGACATAGAAGCCATGG + Intergenic
992427669 5:76674776-76674798 GCCCAGAGCTAGAGTGGGCATGG + Intronic
992644239 5:78797343-78797365 ACCCAGCGAAATGTTGGGCATGG - Intronic
993573048 5:89566802-89566824 GCTCAGAGACACTGAGGGCAGGG + Intergenic
996810848 5:127515077-127515099 ACACAGAGACATGGGGGGGAAGG + Intergenic
997746248 5:136302501-136302523 GCATAGAGACATGGAGGGAAGGG - Intronic
997978529 5:138454432-138454454 GCCCAGAGCCAGTGTGGGGAGGG + Intergenic
999248238 5:150166866-150166888 GCCCACATACATGGTGGCCGCGG - Exonic
1001626988 5:173144456-173144478 GCCCCGAGACTGGGTGGGGAGGG + Exonic
1001753289 5:174147664-174147686 GGCCAGACCCATGCTGGGCAGGG - Intronic
1001854504 5:174999365-174999387 GTGCAGAGGCATGGAGGGCATGG - Intergenic
1003171113 6:3722888-3722910 GCCCAGAGACCTGGCAGGCCGGG + Exonic
1003238832 6:4323587-4323609 GCCCAGAGACTGGCTGGGTAAGG + Intergenic
1006460305 6:34154226-34154248 GCCCTGTGAGATGGTGAGCACGG + Intronic
1007452463 6:41950659-41950681 GCCCTGGGACATGCTGGACATGG + Intronic
1008993961 6:57636935-57636957 GTCAGGAGACATGGTGGTCAGGG - Intronic
1009182564 6:60536025-60536047 GTCAGGAGACATGGTGGTCAGGG - Intergenic
1011101544 6:83728041-83728063 GCCCAGAGACACAGAGGTCAGGG - Intergenic
1012860189 6:104550224-104550246 GCCCTGAGACATGATGGAGAAGG + Intergenic
1013108452 6:107046263-107046285 GCACAGAGACAGGGTGTTCAGGG - Intronic
1013304833 6:108838456-108838478 GCCCAGAGACAAGGGAGGCTTGG + Intergenic
1017593897 6:156008038-156008060 GCTCAGAGAAATTGTGAGCAGGG + Intergenic
1019377199 7:699125-699147 GCCCACAGGCAAGGTGGGAAGGG + Intronic
1020018123 7:4843560-4843582 GCCCAGAGTCAGGCTGGCCATGG - Intronic
1021863078 7:24926601-24926623 GCCCACAGTAAGGGTGGGCATGG - Intronic
1022015550 7:26345845-26345867 CCCCAGAGACATGCAGGGCCTGG + Intronic
1022372725 7:29786089-29786111 GCATAGAGACATGGAGGGAAGGG - Intergenic
1022744113 7:33152030-33152052 GAACAGAGACATGGAGGGAATGG - Intronic
1023255807 7:38311372-38311394 TCCCAGAGACATGGTGGCGGCGG - Intergenic
1023828819 7:44027856-44027878 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1023873872 7:44276557-44276579 GCCCAAAGGCATGATGGACAGGG - Intronic
1024500864 7:50104022-50104044 GCACACAGACATGTTGGGGATGG - Intronic
1025780459 7:64597041-64597063 GCCCAGAGACAAAGAGGCCAAGG - Intergenic
1025978125 7:66385730-66385752 GGCCAGAGATTTGCTGGGCAGGG - Intronic
1027203704 7:76080394-76080416 GGCCAGAGATTTGCTGGGCAGGG - Intergenic
1027267791 7:76503718-76503740 GGCCAGAGCCATGGAGGGCCGGG + Intronic
1029739118 7:102482113-102482135 GCCCCGGGGCAGGGTGGGCAGGG - Intergenic
1029757119 7:102581292-102581314 GCCCCGGGGCAGGGTGGGCAGGG - Exonic
1029775060 7:102680353-102680375 GCCCCGGGGCAAGGTGGGCAGGG - Intergenic
1032792931 7:135255716-135255738 TCCCACAGACCTGGGGGGCAAGG - Intronic
1033469517 7:141632275-141632297 GCCCAAAGACATTGAGGGTAAGG - Intronic
1033504507 7:141986415-141986437 ACCCAGAGACAGTGTGGACATGG + Intronic
1033676112 7:143541736-143541758 GCGTAGAGACATGGAGGGAAGGG + Intergenic
1034220030 7:149436824-149436846 GCGCTGAGAGAGGGTGGGCAGGG + Exonic
1034252398 7:149702823-149702845 GCGCAGAGACATGGTTGGCAGGG - Intergenic
1035761715 8:2073441-2073463 GCCCCGAGACACGATGCGCAGGG - Exonic
1035772807 8:2162223-2162245 GCCCAGAGACACAGTGGGTGAGG + Intronic
1035828058 8:2665437-2665459 GCCCTGAGACCTGGTGGACAAGG + Intergenic
1036762454 8:11518746-11518768 GCCCAGAGACCAGCTGGGGAAGG - Intronic
1044008370 8:86963892-86963914 TCCCTGAGACATGGGTGGCAAGG - Intronic
1044809879 8:96048962-96048984 GCCCAGCTACTCGGTGGGCAGGG + Intergenic
1045197366 8:99945068-99945090 GCGTAGAGACATGGAGGGAAGGG - Intergenic
1047771948 8:128036943-128036965 GCCCAAACCCATGGTGGGCCTGG - Intergenic
1048463147 8:134639442-134639464 TCCCTGGGGCATGGTGGGCAGGG + Intronic
1049603298 8:143517988-143518010 ACCCTGAGACGTGGTGGCCAGGG - Intronic
1050430159 9:5554004-5554026 CCCCAGAGAGAGGGTGGGCTTGG - Intronic
1051575640 9:18612191-18612213 GACCAGAGACATAGCAGGCAAGG + Intronic
1053000235 9:34573936-34573958 GGACAAGGACATGGTGGGCAGGG + Intronic
1054792624 9:69270033-69270055 TGCCAAAGACATGGTGAGCACGG - Intergenic
1056354496 9:85784964-85784986 GCCCATAGACATGGTTTGCTTGG - Intergenic
1060156598 9:121324650-121324672 GCCCAGAGAGGCGGTGGGCTGGG - Intronic
1061857343 9:133449521-133449543 TCCCAGAGACAGTGGGGGCAGGG - Intronic
1061886733 9:133594864-133594886 GCCCAGAGGCAGGCAGGGCAAGG + Intergenic
1062249839 9:135588541-135588563 GACCAGAGCCATGGTGGGGTGGG + Intergenic
1062361246 9:136189359-136189381 GCCCCGAGCCCTGGTGGGGAAGG + Intergenic
1062399781 9:136367305-136367327 CCCCAGGCACAGGGTGGGCAGGG + Intronic
1062523937 9:136970723-136970745 GCCCAGGGACATGGTGGCTGTGG + Intronic
1203747200 Un_GL000218v1:46281-46303 ACCCAGAGATAGGGAGGGCAGGG + Intergenic
1187533793 X:20119123-20119145 GCCCAGTGGAAAGGTGGGCAAGG - Intergenic
1187669950 X:21657818-21657840 GACCAGAGGCCTGCTGGGCAGGG + Exonic
1189186572 X:39060302-39060324 GTGCAGAGCCATGTTGGGCATGG - Intergenic
1190116454 X:47628799-47628821 TCCCAGATACACCGTGGGCATGG - Intronic
1194403660 X:93468021-93468043 TCCCAGAGAAATGGAGGGCTAGG - Intergenic
1195541595 X:106068638-106068660 TCCCAGAGACATAGTGGGCCAGG + Intergenic
1196114658 X:111985839-111985861 TGCCAAAGACAAGGTGGGCATGG - Intronic
1198305619 X:135379790-135379812 GGCTAGAGACATGGTGGGAAAGG - Intergenic
1198692653 X:139301097-139301119 GCACAGTGCCATGGGGGGCAAGG - Intergenic
1200179607 X:154142386-154142408 GCCCAGAGGAATGGAAGGCAGGG - Intergenic
1200770415 Y:7119942-7119964 GCACAGTGACATGGTGGTCCTGG - Intergenic
1201160521 Y:11161276-11161298 ACCCAGAGATAGGGAGGGCAGGG + Intergenic
1201464956 Y:14270255-14270277 GTCCTGAGACATGGTGGTCAGGG - Intergenic
1202599773 Y:26581456-26581478 GCTCTGAGCCATGGTGGGCACGG + Intergenic