ID: 1076701422

View in Genome Browser
Species Human (GRCh38)
Location 10:132275207-132275229
Sequence GCACTGCCCAGAGACATGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 247}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701422_1076701435 21 Left 1076701422 10:132275207-132275229 CCCACCATGTCTCTGGGCAGTGC 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701422_1076701434 20 Left 1076701422 10:132275207-132275229 CCCACCATGTCTCTGGGCAGTGC 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701422_1076701426 -3 Left 1076701422 10:132275207-132275229 CCCACCATGTCTCTGGGCAGTGC 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1076701426 10:132275227-132275249 TGCTGCCCCACCAGGCCCCATGG No data
1076701422_1076701436 28 Left 1076701422 10:132275207-132275229 CCCACCATGTCTCTGGGCAGTGC 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701422 Original CRISPR GCACTGCCCAGAGACATGGT GGG (reversed) Intronic
900130486 1:1085188-1085210 GGGCTGCCCAGAGACCTGGGAGG + Intronic
900612793 1:3551446-3551468 GCACTGCCCAGAGTGATGTGTGG - Intronic
901740526 1:11338916-11338938 GCACTGCCCAGGGCCACGGGAGG + Intergenic
901862534 1:12084115-12084137 GCCCATCCCAGAGACAAGGTAGG + Intronic
902332652 1:15738165-15738187 GCTGTGCCCCGAGTCATGGTGGG + Exonic
902386543 1:16079148-16079170 GCACCACCCAGAGCCATGGCTGG - Intergenic
903346229 1:22685853-22685875 ACAGTGCCCAGAGACAGGCTTGG - Intergenic
904259304 1:29279367-29279389 TCACTTCCCTGGGACATGGTGGG + Intronic
906059148 1:42936947-42936969 CCAATGCCCAGAGACATTTTTGG + Intronic
906157285 1:43621077-43621099 GCACTGCTCAGAAACACAGTTGG - Exonic
906522779 1:46477177-46477199 GAAGGGCCCAGAGACATGGCAGG - Intergenic
906894734 1:49758487-49758509 GAACTGCCCAGGGTCATGGGAGG + Intronic
908605118 1:65790385-65790407 GGAGTTCCCAGAAACATGGTAGG - Intergenic
908711050 1:67014888-67014910 GTATGGCCAAGAGACATGGTTGG - Intronic
909044284 1:70690412-70690434 GAACTTCCCAGAGACTTGGAGGG + Intergenic
909533768 1:76710141-76710163 GCACTGCTCAGAGACATTGAGGG - Intergenic
910764734 1:90770310-90770332 GCAATGCCTAGAGACATTTTTGG - Intergenic
914964711 1:152245122-152245144 GTACAGCCCTAAGACATGGTAGG - Intergenic
914982914 1:152430972-152430994 CCAAGGCCCAGAGAGATGGTGGG - Intergenic
916008344 1:160681765-160681787 GAACAGCCCAGAGACTTGCTGGG + Intronic
916550090 1:165841721-165841743 CCAGTGCCCAGTGTCATGGTTGG + Intronic
918546160 1:185686587-185686609 GCACTGCTCTGAGAGATGGAAGG - Intergenic
918866400 1:189906074-189906096 GAACTTCCCAGAGACTTGGAGGG - Intergenic
920373397 1:205493405-205493427 GCACAGCCCAGAGAAATGCCCGG - Intergenic
922005952 1:221530891-221530913 GGAATGCCCAGAGAAATAGTAGG - Intergenic
922704000 1:227779376-227779398 GCTCCGCCCAGTGACATGGCGGG - Intronic
922926629 1:229352477-229352499 GCAATGTCCAGAGACATTTTTGG + Intergenic
922987152 1:229874719-229874741 GCAATGGCCAGAGAAATGGGAGG + Intergenic
924563666 1:245178216-245178238 GCACAGCACAAACACATGGTAGG - Intronic
1063658532 10:8015689-8015711 GCAGTGCCCGGAAACATGGTGGG + Exonic
1064936375 10:20683252-20683274 CCACTGCCCAGATTAATGGTGGG + Intergenic
1065070859 10:22022439-22022461 GCACAGCACAGACAGATGGTTGG + Intergenic
1067224972 10:44369719-44369741 GCACTGCACAGAGACCTTGCTGG - Intergenic
1067275463 10:44829306-44829328 GCACTGCCCAGGAACCTGGTGGG + Intergenic
1073549250 10:104382253-104382275 GCACAGCCCTGTGACTTGGTTGG - Intronic
1075705158 10:124496233-124496255 TCACAGTCCAGACACATGGTGGG - Intronic
1076701422 10:132275207-132275229 GCACTGCCCAGAGACATGGTGGG - Intronic
1079579663 11:22047856-22047878 GCAATGCCTAGAGACATTTTTGG + Intergenic
1080058012 11:27927400-27927422 GCTCTCCCCAGAGACTTGGAAGG + Intergenic
1082828679 11:57599268-57599290 GCAATGTCCAGAGACATTTTTGG - Intronic
1082979751 11:59108411-59108433 TCACAGGCCAAAGACATGGTGGG - Intronic
1085484646 11:76851746-76851768 GCACTGGCAGGAGACATGGCAGG + Intergenic
1085532310 11:77199171-77199193 GCACTGACCAGACACATGCCAGG + Intronic
1091252690 11:134156688-134156710 GGACAGCCCAGAGACACGGAGGG + Intronic
1091551579 12:1539131-1539153 GCAATGTCCAGAGACATTTTTGG - Intronic
1091656266 12:2348800-2348822 GGACTTCCCAGACACAGGGTGGG + Intronic
1092089792 12:5795050-5795072 GCAGAGCCCAGAGACAAGGAGGG + Intronic
1093093904 12:14951187-14951209 GTACTTGCCAGAGAAATGGTTGG + Intronic
1093496442 12:19763262-19763284 GAACTGCCTAGAGAGTTGGTAGG + Intergenic
1093715213 12:22374243-22374265 GCAATGTCCAGAGACATCTTTGG + Intronic
1096588992 12:52644732-52644754 GCAATGCAAAGAGGCATGGTGGG + Exonic
1099571432 12:84324146-84324168 GCACTGTCCAGAGACACTTTTGG - Intergenic
1099621187 12:85004752-85004774 GAACTTCCCAGAGACTTGGAGGG + Intergenic
1099803748 12:87491259-87491281 GCACTGCCAAGAGCAATGTTTGG - Intergenic
1101745607 12:107539149-107539171 TAAATGCCCGGAGACATGGTAGG + Intronic
1102303532 12:111788300-111788322 GCAATGTCCAGAGACATTTTTGG + Intronic
1102490076 12:113285345-113285367 GCCCTGCCCAGAGACAGGCAGGG + Intronic
1102522177 12:113485262-113485284 GCAATGCCTAGAGACATGTTTGG + Intergenic
1102808714 12:115805090-115805112 ACACTGCACAGATATATGGTTGG + Intergenic
1103991996 12:124805481-124805503 GCAGGGCCCAGGGCCATGGTGGG + Intronic
1104019727 12:124983833-124983855 GCAGTCCCCAGAGCCTTGGTAGG - Intronic
1105480587 13:20772388-20772410 GCAATGCCTAGAGACATTTTTGG + Intronic
1108100137 13:46945652-46945674 GAACTTCCCAGAGACTTGGAGGG - Intergenic
1108711813 13:53040599-53040621 GCAATGCCCAGAGACATTTTTGG + Intronic
1110840931 13:80142289-80142311 GCATTGCTCAGAAAAATGGTGGG + Intergenic
1111403409 13:87770167-87770189 GCACTTCCTAGAGACTTGGAGGG - Intergenic
1111978350 13:94991121-94991143 GCAATTTCCAGAGACTTGGTGGG - Intergenic
1112855915 13:103769190-103769212 GAACTTCCCAGAGACTTGGAGGG - Intergenic
1117125278 14:52616579-52616601 GCACTGCCCCCAGCCATGTTAGG + Intronic
1117301099 14:54429258-54429280 GCAATGTCCAGAGACATTTTTGG + Intronic
1119305987 14:73608569-73608591 GAACTGCCTAGAGACTTGGAGGG - Intergenic
1120836282 14:89040899-89040921 GCACTGCCCTGGGACGTGATCGG - Intergenic
1120937449 14:89911357-89911379 GCACTGCCGAGTGACAAGGGGGG + Intronic
1121661688 14:95639982-95640004 GACCTGCCCAGAGTCATGGAGGG + Intergenic
1122325641 14:100879516-100879538 GAAGTGCCCAGAGTCTTGGTGGG + Intergenic
1123573499 15:21640989-21641011 GAAGTGCCCAGAGACATTTTTGG + Intergenic
1123610119 15:22083605-22083627 GAAGTGCCCAGAGACATTTTTGG + Intergenic
1124632003 15:31343351-31343373 GCAGTGCCCACAGACAAGGCTGG + Intronic
1128800037 15:70491568-70491590 GCTCTGCCCAGGCAGATGGTGGG - Intergenic
1128899983 15:71411798-71411820 GCACTGCCCAGACACACAGATGG - Exonic
1129247193 15:74286755-74286777 CCACAGCCCACAGACATGCTGGG + Intronic
1130917785 15:88319271-88319293 GTACTGCCCTTAGACCTGGTTGG - Intergenic
1132413355 15:101602720-101602742 GCACTGGCCAGGGGCCTGGTTGG + Intergenic
1202982367 15_KI270727v1_random:375402-375424 GAAGTGCCCAGAGACATTTTTGG + Intergenic
1133448403 16:5882546-5882568 GCACTGAGCAGAGACCTGGAGGG + Intergenic
1134090892 16:11391166-11391188 GCCCTGCCCAGCGCCAGGGTGGG - Intronic
1134358351 16:13505841-13505863 TCCCTGCCCAAAGACATGGGGGG - Intergenic
1135134045 16:19874681-19874703 GCACTGTCTAGAGACATTTTGGG - Intronic
1137643645 16:50055896-50055918 GCAATGGCCAAAGACATGTTTGG + Intergenic
1138063176 16:53912760-53912782 GCACTACCCAGGAAAATGGTAGG - Intronic
1138113197 16:54340530-54340552 CCACTTCCCAGAGCCAGGGTAGG - Intergenic
1138154856 16:54693609-54693631 GCAATGCCTAGAGACATTTTTGG - Intergenic
1138237535 16:55397588-55397610 CCACTGGCCAGTGACATGGCAGG + Intronic
1139200560 16:64972149-64972171 GCACTGCCCAGATAGGTGGCTGG - Intronic
1139487830 16:67268809-67268831 GCAATGCCCAGAGACATTTTTGG + Intronic
1139635028 16:68253281-68253303 GCAAGGCCCAGAGAAATGATGGG - Intronic
1141150244 16:81559503-81559525 GCACTGCATAGTGACGTGGTCGG + Intronic
1141646385 16:85370196-85370218 CCAGTGCCCAGGGACAGGGTGGG - Intergenic
1141705478 16:85662198-85662220 GCACTGCCCCGGGTCAGGGTAGG + Intronic
1143456994 17:7074691-7074713 GGACTGCCCAGAGGCATGAGGGG + Exonic
1145207251 17:20991147-20991169 GCTCTGGCCAGGGGCATGGTGGG + Intergenic
1146523732 17:33547855-33547877 GCACTGCCCAGGCACACAGTAGG + Intronic
1146795478 17:35777299-35777321 CCATTGCCCAGAAACACGGTGGG + Intronic
1147972808 17:44228797-44228819 TCACTGCCCACAGAGATGATAGG + Intergenic
1148125736 17:45235895-45235917 ACACTTCCCAGGGACTTGGTAGG - Intronic
1148605481 17:48926125-48926147 GCAATGCCCAGAAACCTGGATGG + Intronic
1151033552 17:70771251-70771273 GCACTGCCTGGAGACATTTTTGG + Intergenic
1151542892 17:74773906-74773928 GCACTGACCCGAGACAGGATAGG - Intronic
1152043855 17:77923399-77923421 GCAGTGCTCAGAGAGCTGGTGGG + Intergenic
1152203142 17:78958767-78958789 GCACTGCCCAGAGTCAGGTGGGG - Intergenic
1152412315 17:80133714-80133736 GCACTGGCCAGAGCTGTGGTGGG + Intergenic
1154300423 18:13186631-13186653 GCTCTGCCCAGGGCCACGGTCGG + Intergenic
1154436311 18:14344623-14344645 TCACTGCCCAATGACATGTTGGG - Intergenic
1156967048 18:43107004-43107026 GTACTGCTCACAGACATGGAAGG - Intronic
1158011223 18:52730198-52730220 GCAATGTCCAGAGACATTTTTGG + Intronic
1160571457 18:79820062-79820084 GCACTGCCCAGACACAGAATAGG - Intergenic
1161566639 19:5006231-5006253 ACACTACCCAGAGGCAGGGTGGG - Intronic
1161801236 19:6417704-6417726 GCACTGGCCAGGGGCAGGGTGGG + Intronic
1162760609 19:12886188-12886210 GCCCTGCCCAGGGACATCGCGGG + Intronic
1163157852 19:15449207-15449229 GCCCTCCCCAGGGAGATGGTGGG + Intronic
1164590083 19:29501942-29501964 GCACTGCCCAGTGACTTGAAGGG - Intergenic
1164762786 19:30740400-30740422 GCAGTGTCCAGAGACATTTTTGG - Intergenic
1166412044 19:42561845-42561867 GCACTTCCCAGGGTCATGGGTGG + Intergenic
1166417431 19:42606533-42606555 GCAATGTCCGGAGACATTGTTGG + Intronic
1167617934 19:50546493-50546515 GCCCCACCCAGAGACATGGATGG - Intronic
1168406479 19:56113000-56113022 GCACTTCCAAGAGGCAGGGTGGG - Intronic
925159321 2:1672984-1673006 TCATTTCCCAGAGCCATGGTGGG + Intronic
925373311 2:3362916-3362938 GTACTTCCCATACACATGGTAGG + Intronic
925404903 2:3599702-3599724 GCACTGCCCAGAGACCTCCCGGG - Intronic
926394325 2:12425861-12425883 GCAATGCCAAGGGTCATGGTGGG - Intergenic
928490417 2:31777851-31777873 GAGCTGCCCAGAGAAGTGGTAGG + Intergenic
928923384 2:36550178-36550200 TCACTGGCCAGAGACATTGATGG + Exonic
936265847 2:111005894-111005916 GTACTGCTCTGAGACATTGTGGG + Intronic
936401375 2:112166969-112166991 ACACAGCCCAGAGACAAAGTAGG - Intronic
936691261 2:114892051-114892073 TTTCAGCCCAGAGACATGGTGGG - Intronic
936729035 2:115358507-115358529 GAACTTCCCAGAGACTTGGAGGG - Intronic
937305059 2:120865960-120865982 GCACTGCCCAGACTCAGAGTGGG + Intronic
938239461 2:129732085-129732107 GCATAGCTCAGAGACATGGCTGG - Intergenic
938721497 2:134071216-134071238 GGGCTACCCAGAGAAATGGTGGG + Intergenic
939307618 2:140429767-140429789 CCACTGCACGGAGACATGATGGG - Intronic
942077788 2:172372617-172372639 GCATTGCCTAGAGCCATGCTGGG + Intergenic
942757624 2:179360970-179360992 GCAATGACCAGAGACATGTTTGG - Intergenic
942767377 2:179472791-179472813 GCCCTGCCTGGAGACAGGGTTGG - Intronic
945776939 2:214116604-214116626 CCACTGCGCAGAGACCTGCTGGG + Intronic
945785538 2:214231124-214231146 GCACTGTTCTGGGACATGGTTGG - Intronic
946137931 2:217663568-217663590 GCACAGCCCTGAGACAAGGAGGG + Intronic
946361612 2:219222377-219222399 CCACTGCCCAGAGACCTGCAGGG - Exonic
947990769 2:234485711-234485733 GCAATGTCCTGAGACATGCTTGG - Intergenic
1168963344 20:1883588-1883610 GCCCTGCCCGGAGCCAGGGTGGG + Intergenic
1170321716 20:15106764-15106786 GCACTGCCCAGATACATGTTAGG + Intronic
1171380006 20:24727656-24727678 GCACTGGGAAGAGACATGGCTGG + Intergenic
1171420076 20:25012088-25012110 CCACTGCACAGCGACATGCTGGG - Intronic
1171421426 20:25020354-25020376 GCACTCCCCAGATCCATGGGCGG + Intronic
1172293166 20:33790489-33790511 GCAATGCCTAGAGACATTTTTGG - Intronic
1172591691 20:36122384-36122406 CCACTGCCCAGAGAAAGGATGGG - Intronic
1173284580 20:41658729-41658751 GCACTTCCCACACACACGGTGGG - Intergenic
1174730518 20:52912136-52912158 GAACTGCCTAGAAACATAGTGGG - Intergenic
1175449166 20:59047752-59047774 GCACTGTCTGGAGACATGCTCGG + Intergenic
1175604228 20:60299228-60299250 GCACTGGCCATACACATGCTCGG + Intergenic
1178053321 21:28771410-28771432 GTAATGCCCAGAGACATGTTTGG + Intergenic
1178580869 21:33837051-33837073 TCACTGCCCAGAGGGATGATGGG + Intronic
1179270934 21:39850560-39850582 GCACTGCCCACAGCCAGGGCTGG - Intergenic
1179324554 21:40328557-40328579 TCACTGCCCAGAGCAATGTTAGG - Intronic
1179518264 21:41924727-41924749 GCAGTGCTCAGAGTCAGGGTTGG - Intronic
1183151318 22:36039953-36039975 GAACTTCCTAGAGACTTGGTGGG - Intergenic
1185338127 22:50279841-50279863 GCCCTGGCCAGAGGCATGGACGG + Intronic
950008024 3:9703991-9704013 GCTCCGCCGAGAGACATGGCTGG - Exonic
951499244 3:23365594-23365616 ACACTGCCCAAAGACATCATAGG + Intronic
954038964 3:47869876-47869898 GCACAGCCCAGAGGCCTGCTGGG + Intronic
954115639 3:48465637-48465659 GAACTGCCCAGAGAACTGGCTGG + Exonic
955015280 3:55064078-55064100 GCCCTGCCCAGTTACCTGGTGGG + Intronic
955212084 3:56951574-56951596 GCACACCCCAGAGACATTGCTGG - Intronic
956204640 3:66742510-66742532 GCAATGTCCAGAGACATTTTGGG - Intergenic
956839077 3:73120547-73120569 TCTCTGACCAGAGTCATGGTTGG + Intergenic
960478449 3:118159343-118159365 GTACTTCCTAGAGACATGGAGGG - Intergenic
963982536 3:151555806-151555828 ACACAGGCCAGAGACATGGGGGG - Intergenic
964048612 3:152362688-152362710 GCAATACCCAGAGATATGTTCGG - Intronic
967731550 3:192911748-192911770 CCACTGCCCAGAACCATGGAGGG + Intronic
969589549 4:8114070-8114092 GCACAGCCCTGACACATGGGTGG + Intronic
969635340 4:8365914-8365936 GCACCGTCCTGAGACATGCTGGG + Intergenic
973967905 4:56182587-56182609 ACACTGCCCTGACACAGGGTAGG + Intronic
974877655 4:67717696-67717718 GCTGTCACCAGAGACATGGTGGG + Intergenic
975310236 4:72896098-72896120 GCACAGCCCTGGGACATAGTAGG - Intergenic
976283448 4:83347685-83347707 GAACTTCCCAGAGACTTGGAGGG - Intergenic
978810105 4:112840254-112840276 GCACTGGCCCAGGACATGGTAGG + Intronic
981040457 4:140217124-140217146 CCGCTGCACAGAGACATGATGGG - Intergenic
981184339 4:141783249-141783271 GAACTTCCTAGAGACTTGGTAGG - Intergenic
981516558 4:145616459-145616481 GCAATGTCCAGAGACATTTTTGG - Intergenic
982228348 4:153186019-153186041 GCAATGTCTAGAGACATTGTTGG + Intronic
982357174 4:154483722-154483744 CCACAACCCAGAGAGATGGTTGG - Intronic
982947500 4:161643952-161643974 GCACTGTACTGACACATGGTAGG - Intronic
986735437 5:10664403-10664425 TCACTGCCCAGAGGGATGATGGG - Intergenic
989505638 5:42224094-42224116 GCCCTGCCTAGACACATTGTAGG - Intergenic
995347432 5:111136582-111136604 GCACTGCCCAGAGACAGTTAGGG + Intergenic
995469457 5:112485141-112485163 GTACTGCCCAGAGAAACAGTGGG - Intergenic
998618016 5:143762042-143762064 ACACTGCCCAGTAACATGGTTGG - Intergenic
999210549 5:149884775-149884797 ACACTGCTCAGAGACGAGGTAGG - Exonic
999322869 5:150625681-150625703 GCACTGTCCAGAGCCCTGGCAGG + Intronic
999501186 5:152148266-152148288 CCACTGTCCAGAGACACCGTAGG - Intergenic
1001626985 5:173144451-173144473 GCGCTGCCCCGAGACTGGGTGGG + Exonic
1001893897 5:175362465-175362487 GCACAGCCCAGAGCCCTGGGTGG - Intergenic
1001953457 5:175832024-175832046 GCACAGACAAGAGACATGGAGGG - Intronic
1003767964 6:9262086-9262108 GAACTTCCCAGAGACTTGGAGGG - Intergenic
1006193005 6:32220930-32220952 GCCCTGCCCAGAGAGAGGGGCGG + Intronic
1007502655 6:42310511-42310533 GCAATGTCCAGAGACATTGTTGG + Intronic
1009051500 6:58282216-58282238 GAACTTCCCAGAGACTTGGAAGG + Intergenic
1011382581 6:86758966-86758988 GAACTTCCCAGAGACTTGGAGGG + Intergenic
1012490823 6:99780665-99780687 GAACTGCTCAGAGAAGTGGTAGG - Intergenic
1013304832 6:108838451-108838473 GCTGTGCCCAGAGACAAGGGAGG + Intergenic
1013354813 6:109337326-109337348 GTACTGACCTGAGCCATGGTTGG + Intergenic
1013414949 6:109916765-109916787 GCACACCTCAGAGACATTGTGGG - Intergenic
1015151668 6:130046043-130046065 GCAGTGCAGAGGGACATGGTAGG + Intronic
1018069215 6:160147008-160147030 CCACTGCTCAGAGAGCTGGTGGG + Intronic
1018631546 6:165826677-165826699 CCACTGACCAGAGGCACGGTGGG + Intronic
1019549139 7:1593620-1593642 GCACCGCCCTGAGGCAAGGTGGG - Intergenic
1019686024 7:2382724-2382746 ACACTGCCCAGAGCCAGGGTCGG - Intergenic
1022627298 7:32051006-32051028 GCACAGCCCAGAGGCAGGCTGGG + Intronic
1023766208 7:43513391-43513413 GCACTGCCCAAAGACATCAATGG + Intronic
1024202632 7:47122259-47122281 GCAATGACCAGAGACATTCTTGG + Intergenic
1027927159 7:84480557-84480579 GCAGTGCCCAGGGTCAGGGTTGG + Intronic
1028133737 7:87205778-87205800 GCACTTCCTAGAGACTTGGAGGG - Intronic
1028572532 7:92306558-92306580 GTAGTGCACAGAGACATGGTGGG + Intronic
1029290599 7:99499694-99499716 GCACTGCCCAGAGAGCGGGGAGG - Exonic
1029790009 7:102832778-102832800 GCACTGCCAAGGGACAAGGCAGG - Intronic
1031606863 7:123779334-123779356 TCACTGCCCCGAGAAATGTTAGG - Intergenic
1035779594 8:2217159-2217181 GCACTGTCCTGCGAGATGGTGGG + Intergenic
1037022663 8:13993081-13993103 ACACTGGCCAGAGACCTGGAAGG + Intergenic
1037525762 8:19722664-19722686 GCATTGACCAGAGTCATGGATGG + Intronic
1041851986 8:62402926-62402948 GAACTTCCTAGAGACTTGGTGGG + Intronic
1042216632 8:66434764-66434786 GCACTGGCCAGAGAGGTTGTGGG + Intronic
1043162465 8:76863150-76863172 GCACTGCTGAGAGACAGGGCAGG - Exonic
1043345726 8:79296051-79296073 GAACTTCCCAGAGACTTGGAGGG + Intergenic
1044233868 8:89808367-89808389 GAACTTCCCAGAGACTTGGAGGG + Intergenic
1046618445 8:116502284-116502306 TCACTGCCCACATACATGGCAGG + Intergenic
1048807425 8:138253650-138253672 GCCATGCCCAGAGACATGTTTGG - Intronic
1048808858 8:138266677-138266699 GCACTGCCCAGGGTTATTGTGGG + Intronic
1049525853 8:143126666-143126688 GCCCTGCCCAGAAACAAGCTGGG + Intergenic
1049756277 8:144312530-144312552 GTGCTGCCCAGACACATGGCAGG + Intronic
1052054060 9:23883413-23883435 GAACTTCCCAGAGACTTGGAGGG - Intergenic
1055140770 9:72874702-72874724 GCAATGTCCAGAGACATTTTTGG + Intergenic
1055885860 9:81062675-81062697 GAACTTCCCAGAGACTTGGAGGG + Intergenic
1056658510 9:88527835-88527857 GCCCTGCCGAGTGACTTGGTGGG - Intergenic
1057222110 9:93263008-93263030 GCAGTGCCCAGAGACTAGGAGGG + Intronic
1060157895 9:121332617-121332639 GCACTGACCGGTGACATGGGTGG - Exonic
1060733828 9:126053851-126053873 TCACTGCCAAGGGGCATGGTGGG - Intergenic
1060833954 9:126740874-126740896 GCACTTAACAGAGACAAGGTGGG - Intergenic
1062134455 9:134917583-134917605 GCATTGCCCAGGGTCATGGAGGG - Intronic
1062312144 9:135944638-135944660 GCCCTGCCCAGAGACCGGGAGGG - Intronic
1062424474 9:136499662-136499684 GCTCTGCCCAGAGAGGGGGTGGG + Intronic
1185831524 X:3307719-3307741 GCAATGTCCAGAGACATTTTTGG + Intergenic
1186398843 X:9238071-9238093 GCAATGTCTAGAGACATTGTTGG - Intergenic
1186407102 X:9313729-9313751 ACACTGCTCAGAGAGGTGGTGGG + Intergenic
1186535895 X:10348104-10348126 GCATTCCTCAGAGACATTGTGGG - Intergenic
1187694124 X:21901318-21901340 GCAGTGTCCAGAGACATTTTTGG + Intergenic
1188431886 X:30112674-30112696 GCACTGCACAGAGATATGAAAGG - Intergenic
1189940739 X:46117931-46117953 GAGCTGCCTAGAGAAATGGTGGG - Intergenic
1192539082 X:71953072-71953094 CCACTCCCCAGAGACAGGCTGGG - Intergenic
1193711786 X:84889483-84889505 GCAATGTCTGGAGACATGGTTGG - Intergenic
1195541594 X:106068633-106068655 CCATTTCCCAGAGACATAGTGGG + Intergenic
1196007874 X:110854580-110854602 GCACTGCCCAGCTCCATTGTGGG + Intergenic
1200094153 X:153649483-153649505 GCACTGCCCAGATAGAGGTTGGG - Exonic
1200544535 Y:4503527-4503549 GCACTGCCCAGGAACATGAAGGG - Intergenic