ID: 1076701423

View in Genome Browser
Species Human (GRCh38)
Location 10:132275208-132275230
Sequence AGCACTGCCCAGAGACATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 309}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701423_1076701437 30 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701423_1076701435 20 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701423_1076701436 27 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701423_1076701426 -4 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701426 10:132275227-132275249 TGCTGCCCCACCAGGCCCCATGG No data
1076701423_1076701434 19 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701423 Original CRISPR AGCACTGCCCAGAGACATGG TGG (reversed) Intronic
900399425 1:2466990-2467012 AGCACTGCCAAGGGTCATTGAGG - Intronic
900817253 1:4857945-4857967 AGAACTTCCTAGAGACTTGGAGG + Intergenic
901439709 1:9270483-9270505 AGCACATCTCAGAGAGATGGAGG - Exonic
901749241 1:11395892-11395914 AGCATGCCCCAGAGACCTGGAGG - Intergenic
901823756 1:11847279-11847301 AGCCCAGCCCAGAGAGATGGAGG - Exonic
903262414 1:22138631-22138653 TTCACTGCCCAGAGCCACGGAGG + Intronic
903768639 1:25750308-25750330 AGCACAGCCCAGATATCTGGTGG + Intronic
903968064 1:27102066-27102088 AGCACTGTCCAAGGACAAGGAGG - Exonic
904850504 1:33455646-33455668 AGCACTTCCCAGAAATATGCAGG - Intergenic
905262327 1:36728730-36728752 AGGACTGCCCTGAGATACGGAGG - Intergenic
905857425 1:41323175-41323197 AGGACTGCCCAGAGAAATAGGGG - Intergenic
906791048 1:48659102-48659124 AGAGCTGCCCAGTGACCTGGTGG + Intronic
906981233 1:50631736-50631758 AGCACTTACCACAGACATTGTGG - Intronic
907299863 1:53480076-53480098 AGCACTAGCCAGAAGCATGGAGG - Intergenic
908808904 1:67959145-67959167 AGCACTGCCCTAACACATGGAGG - Intergenic
909044283 1:70690411-70690433 GGAACTTCCCAGAGACTTGGAGG + Intergenic
909533769 1:76710142-76710164 AGCACTGCTCAGAGACATTGAGG - Intergenic
909831894 1:80202605-80202627 AGGGCTGCGTAGAGACATGGGGG - Intergenic
911818696 1:102388051-102388073 TGCACTGCCAAGAGACAAGTTGG + Intergenic
912480052 1:109976289-109976311 AGCAGTACCCACAGACAGGGAGG + Intergenic
913245405 1:116866110-116866132 TCCACTGCACAGAGACATGACGG - Intergenic
913955293 1:143284924-143284946 AGCTCAGCTCAGACACATGGAGG + Intergenic
918866401 1:189906075-189906097 GGAACTTCCCAGAGACTTGGAGG - Intergenic
919988235 1:202690632-202690654 AGAACCGTCCAGAGACTTGGTGG - Intronic
920334658 1:205236891-205236913 AGTTCTGCCTAAAGACATGGTGG + Intronic
921193035 1:212726560-212726582 AGATGTGCCCAGAGACAAGGTGG - Intronic
921358032 1:214304930-214304952 AGCACTGTCCAAAGAGATGAGGG - Intronic
922704001 1:227779377-227779399 CGCTCCGCCCAGTGACATGGCGG - Intronic
924738227 1:246778523-246778545 ACCACAGGCCAGAGACCTGGAGG + Intergenic
924749352 1:246871170-246871192 ACCACTGTCCTAAGACATGGGGG - Intronic
1063658531 10:8015688-8015710 CGCAGTGCCCGGAAACATGGTGG + Exonic
1063885028 10:10568651-10568673 AGATCTGCACAGAGGCATGGCGG + Intergenic
1064256811 10:13749296-13749318 GGCACTGCCCAGTGTCCTGGTGG - Intronic
1064310515 10:14208345-14208367 AGCCCTCCCCAGAGACCTGGGGG - Intronic
1067275462 10:44829305-44829327 TGCACTGCCCAGGAACCTGGTGG + Intergenic
1067565020 10:47330216-47330238 AGAATCGCCCAGTGACATGGAGG - Intergenic
1067741477 10:48898819-48898841 AGCACTGCCCAGAACCATCAGGG - Intronic
1068495161 10:57777443-57777465 AGAACTTCCTAGAGACTTGGAGG - Intergenic
1069847950 10:71385634-71385656 AGCTCTGGCCAGGGAAATGGGGG + Intergenic
1072971298 10:100020097-100020119 AGCACTGCCTGGAGCCATGAAGG - Intergenic
1073320887 10:102615680-102615702 CGCATGGCCCAGTGACATGGGGG - Intronic
1076461077 10:130647909-130647931 AGAACTGCACTGAGGCATGGCGG + Intergenic
1076527388 10:131120642-131120664 AGCACTACCCAGATGGATGGAGG + Intronic
1076672845 10:132132712-132132734 AGCCATGCCCAGAAGCATGGAGG + Intronic
1076701423 10:132275208-132275230 AGCACTGCCCAGAGACATGGTGG - Intronic
1077475828 11:2790027-2790049 AGCCCTGCCCTGGGACTTGGAGG + Intronic
1077516775 11:3006975-3006997 AGCAGTTCCCTCAGACATGGAGG + Intronic
1077793880 11:5470465-5470487 GGCACAGAGCAGAGACATGGAGG - Intronic
1077850580 11:6071915-6071937 ACCACTGCACACAGACATGAGGG + Intergenic
1078214012 11:9296336-9296358 ACCACTGGCCAGGCACATGGTGG + Intronic
1078234355 11:9470374-9470396 AGTACTGTGCAGAAACATGGAGG + Intronic
1079147085 11:17862530-17862552 AGCACTGCCCAGGGACAGCACGG + Intronic
1079203508 11:18394767-18394789 AGCACAGCCCAGAGACGTCTGGG + Intronic
1079230774 11:18646884-18646906 GCCACTGCACAGAGACATGATGG - Intergenic
1081742086 11:45447992-45448014 AGGACTGCCCAGGGACAGGGGGG + Intergenic
1084506960 11:69574493-69574515 AGCCCAGCCCAGAGACAGGGAGG + Intergenic
1084613035 11:70216203-70216225 GCCACTGCACAGAGACATGATGG + Intergenic
1089301017 11:117498524-117498546 AGCACCTCCCTGAGACCTGGGGG - Intronic
1089754696 11:120678102-120678124 GGCACTGCCCAGAGGCCTCGGGG - Intronic
1089784858 11:120900672-120900694 AGCATTGAGCAGAGACCTGGTGG + Intronic
1090052316 11:123390351-123390373 AGCAATGCCCAGAGACAGGCAGG - Intergenic
1090415360 11:126536621-126536643 AGCATTGCCCAGGGCCATGAGGG - Intronic
1091252689 11:134156687-134156709 CGGACAGCCCAGAGACACGGAGG + Intronic
1092089791 12:5795049-5795071 AGCAGAGCCCAGAGACAAGGAGG + Intronic
1094314809 12:29127791-29127813 AGAACTGCAAAGAGAAATGGAGG - Intergenic
1097758064 12:63428330-63428352 AGCACTTCCTAGAGACTTGGAGG - Intergenic
1097794424 12:63846358-63846380 AAAACTGCACAGAGAAATGGTGG - Intronic
1098920169 12:76295460-76295482 GCCACTGCACAGAGACATGATGG - Intergenic
1099621186 12:85004751-85004773 GGAACTTCCCAGAGACTTGGAGG + Intergenic
1101303657 12:103505637-103505659 AGCACTGCCCAGGCCCCTGGGGG + Intergenic
1101865835 12:108518737-108518759 AGCTCTGCGCAGGGTCATGGAGG + Exonic
1102431737 12:112889360-112889382 AGCCAGCCCCAGAGACATGGAGG + Intronic
1102490075 12:113285344-113285366 GGCCCTGCCCAGAGACAGGCAGG + Intronic
1102875241 12:116444033-116444055 CGCACTGGCGGGAGACATGGGGG - Intergenic
1103852642 12:123943336-123943358 AGCACTGCACAGGTACATCGGGG - Exonic
1104925072 12:132309759-132309781 AGCACTGACCACAGACCGGGTGG - Intronic
1105206038 13:18225101-18225123 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1106209394 13:27627374-27627396 AGCACAGTCCTGAGAAATGGTGG + Intronic
1108100138 13:46945653-46945675 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1110840930 13:80142288-80142310 AGCATTGCTCAGAAAAATGGTGG + Intergenic
1111403410 13:87770168-87770190 GGCACTTCCTAGAGACTTGGAGG - Intergenic
1112855916 13:103769191-103769213 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1113046947 13:106166953-106166975 AGCCCTGCACAGAGATAGGGAGG + Intergenic
1113412652 13:110103933-110103955 CGCAGTGCCCAGAGAAATGCTGG + Intergenic
1114064555 14:19050457-19050479 AGCCCTCCTCAGAGACATGGGGG - Intergenic
1114097706 14:19349545-19349567 AGCCCTCCTCAGAGACGTGGGGG + Intergenic
1116649809 14:47575485-47575507 AGCAGTTCCAAGTGACATGGTGG - Intronic
1118316090 14:64726964-64726986 AGCACAGGCCACAGACAGGGGGG + Intronic
1119305988 14:73608570-73608592 AGAACTGCCTAGAGACTTGGAGG - Intergenic
1120937448 14:89911356-89911378 GGCACTGCCGAGTGACAAGGGGG + Intronic
1121011696 14:90523773-90523795 ACCCCTGCCCACAGGCATGGTGG + Intergenic
1121101009 14:91250324-91250346 AGCACAGACCACAGACCTGGAGG + Intronic
1121192193 14:92040376-92040398 AGCAGTGCCGGGAGACTTGGCGG + Exonic
1121661687 14:95639981-95640003 TGACCTGCCCAGAGTCATGGAGG + Intergenic
1122227915 14:100290501-100290523 AGCTCTGCCCACTGACAAGGGGG - Intergenic
1122238649 14:100347343-100347365 AGCAGTGGCCAGAGACTAGGAGG - Intronic
1122304671 14:100755195-100755217 AGCACTTCTCAGAGACCTGTGGG + Intergenic
1122325640 14:100879515-100879537 AGAAGTGCCCAGAGTCTTGGTGG + Intergenic
1124347207 15:28930838-28930860 AGCACTCCCGAGGGGCATGGTGG - Intronic
1124651827 15:31479687-31479709 ACCCCTCCCCAGAGACAGGGCGG + Exonic
1127497108 15:59523770-59523792 AGAACTGCCAAGAGACAAGAAGG - Intergenic
1128621729 15:69156995-69157017 AGCACTGCTGAGAGACGTGCAGG + Intergenic
1128800038 15:70491569-70491591 AGCTCTGCCCAGGCAGATGGTGG - Intergenic
1131217140 15:90547639-90547661 GGCCCTGCCTAGAGACATGAGGG - Intronic
1131336726 15:91556139-91556161 AGCACGCCCCAGAGGCATGGTGG + Intergenic
1133448402 16:5882545-5882567 GGCACTGAGCAGAGACCTGGAGG + Intergenic
1133569110 16:7024248-7024270 ATGAATGCACAGAGACATGGTGG + Intronic
1134263895 16:12676171-12676193 AGGACTGCCAGGGGACATGGTGG + Intronic
1134358352 16:13505842-13505864 CTCCCTGCCCAAAGACATGGGGG - Intergenic
1135134046 16:19874682-19874704 AGCACTGTCTAGAGACATTTTGG - Intronic
1135673721 16:24396352-24396374 GGCACTGCACAGTGACATAGAGG - Intergenic
1137530495 16:49276073-49276095 AGCTCTCCCCAGGGACCTGGAGG - Intergenic
1139013330 16:62659872-62659894 ATCACTGCCCAGAGATAATGAGG + Intergenic
1139635029 16:68253282-68253304 AGCAAGGCCCAGAGAAATGATGG - Intronic
1139853150 16:69962546-69962568 AGCAATGCCCAGGGCCAGGGTGG + Intronic
1139882121 16:70185454-70185476 AGCAATGCCCAGGGCCAGGGTGG + Intronic
1140370387 16:74410050-74410072 AGCAATGCCCAGGGCCAGGGTGG - Intronic
1140486792 16:75299930-75299952 AGCACTACACAGAGACAGTGAGG + Intronic
1140684872 16:77424090-77424112 ACCAAGGCCCAGAGACATGAAGG + Intronic
1141805540 16:86338998-86339020 AGCACTGCCCATTGGCATGTGGG - Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1144074495 17:11704537-11704559 AGCACTGACCAGACAGCTGGGGG + Intronic
1144872689 17:18380701-18380723 AGCACTGCCCCGCCACATGAGGG - Intronic
1145262020 17:21360150-21360172 AGCCCTGAACAGAGACAAGGTGG - Intergenic
1146647759 17:34586486-34586508 TGCACTGCCCAGAGAAAGGGGGG + Intronic
1147445832 17:40474807-40474829 AGCTCAGCCCAGAGAGAAGGAGG + Intergenic
1148519766 17:48261602-48261624 AGCAGTGATCAGAGTCATGGGGG + Intronic
1150248186 17:63691448-63691470 AGCACTCCCCTGAGGCATGCAGG + Intronic
1151748561 17:76024298-76024320 AGCACTGCCCCGCCACATGAGGG + Intronic
1152175865 17:78786779-78786801 TGCTCTGCCCAGAGGCGTGGGGG - Intergenic
1152203143 17:78958768-78958790 TGCACTGCCCAGAGTCAGGTGGG - Intergenic
1152206195 17:78975978-78976000 AGCTCTGCCCAGAGCCTGGGTGG + Exonic
1152223808 17:79083464-79083486 AGAACCTGCCAGAGACATGGGGG - Exonic
1155159748 18:23185962-23185984 AGCAGTGCAAGGAGACATGGGGG + Intronic
1156534206 18:37847218-37847240 AGCACTGCCCAGAGGGGTGTGGG + Intergenic
1156558702 18:38097020-38097042 ACCACTGCCCAGAGATATCCAGG - Intergenic
1156799681 18:41094991-41095013 TGCACTGCCATGAGAAATGGTGG + Intergenic
1157726775 18:49970419-49970441 AGCACTCACCACAGTCATGGTGG + Intronic
1157781678 18:50445253-50445275 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1158604556 18:58883798-58883820 AGCAATGTCCAGAGACATTTTGG - Intronic
1159355676 18:67335411-67335433 GCCACTGCCCAGAGGCAGGGAGG - Intergenic
1159985189 18:74833497-74833519 AGCACTGCACAGAGAGGTGTAGG + Intronic
1161384787 19:3985206-3985228 AGCGCGGCGCACAGACATGGCGG + Intronic
1161498745 19:4601586-4601608 AGCAAGGGCCAGAGACAGGGAGG + Intergenic
1162173662 19:8813068-8813090 AGCTCTGGCCAGTGACTTGGGGG - Intronic
1162418500 19:10552558-10552580 AGCAGGGCCAAGAGACAGGGAGG - Intronic
1162760608 19:12886187-12886209 TGCCCTGCCCAGGGACATCGCGG + Intronic
1164590084 19:29501943-29501965 GGCACTGCCCAGTGACTTGAAGG - Intergenic
1166299598 19:41906438-41906460 AGCACTGGCCAGGGGCAAGGAGG - Exonic
1167029192 19:46945928-46945950 AGCACTGGCTAGAGATGTGGAGG - Intronic
1168182751 19:54673459-54673481 AGAACTGCCCCCAGACATGGAGG + Intronic
925013664 2:505105-505127 AGGAGTGCCCAGTGACAAGGAGG - Intergenic
925159320 2:1672983-1673005 ATCATTTCCCAGAGCCATGGTGG + Intronic
925383108 2:3441941-3441963 ACAACTGCCCATGGACATGGGGG - Intronic
925404904 2:3599703-3599725 GGCACTGCCCAGAGACCTCCCGG - Intronic
925915002 2:8598394-8598416 AGCACTGGGACGAGACATGGGGG + Intergenic
926394326 2:12425862-12425884 AGCAATGCCAAGGGTCATGGTGG - Intergenic
927341991 2:21993071-21993093 AGAACTTCCTAGAGACTTGGGGG - Intergenic
927430156 2:23020736-23020758 AGCACCTCCTAGGGACATGGAGG + Intergenic
927930479 2:27040475-27040497 AGCACTGCCATGAGGCATGCAGG + Exonic
929556285 2:42927535-42927557 GGCACTGCCCAGACACAGGGAGG + Intergenic
930106201 2:47641961-47641983 AGGAGTGGCCAGAGACATAGGGG - Intergenic
930698173 2:54432482-54432504 ATCTCTGGGCAGAGACATGGTGG + Intergenic
932107143 2:68954400-68954422 AGCAATGCCCATAGACATTAGGG + Intergenic
932159180 2:69445354-69445376 GCCACTGCACAGAGACATGATGG + Intergenic
932265591 2:70364793-70364815 AGGACTGCCCAGATTCAAGGGGG + Intergenic
932568204 2:72922675-72922697 ACCAAAGCCCAGAGACTTGGAGG + Intronic
933646137 2:84814101-84814123 AGAACTGCCCATGGACATGGAGG + Exonic
935089632 2:99882427-99882449 AGCACTGCACAGAAGCCTGGGGG + Intronic
935445367 2:103150785-103150807 AACAATGCCCTGAGTCATGGTGG - Intergenic
935757832 2:106290620-106290642 AGGACTGCCCAGCAACAGGGCGG + Intergenic
935792938 2:106610843-106610865 ACCAGTGCCCAGAGAAATGTAGG - Intergenic
936470551 2:112795093-112795115 AGGAAAGCCCAGAGACATGTGGG - Intergenic
936729036 2:115358508-115358530 GGAACTTCCCAGAGACTTGGAGG - Intronic
937305058 2:120865959-120865981 AGCACTGCCCAGACTCAGAGTGG + Intronic
937930129 2:127198075-127198097 AGCACTGCCCATTAACCTGGGGG - Intronic
940468623 2:154064557-154064579 AGCACTGGGCAGAGTCATGATGG + Intronic
940747629 2:157586680-157586702 AGCACACCCCAGAGAGATAGAGG - Intronic
941984346 2:171495666-171495688 AGAACTGCCCAGACTCATGAAGG + Intergenic
942077787 2:172372616-172372638 AGCATTGCCTAGAGCCATGCTGG + Intergenic
942453838 2:176124511-176124533 AGCACTTTTCAGAAACATGGGGG - Exonic
943928853 2:193823377-193823399 AGCACTGTCCATTGTCATGGTGG + Intergenic
944478011 2:200126611-200126633 AGAACTTCCTAGAGACTTGGAGG - Intergenic
946137930 2:217663567-217663589 GGCACAGCCCTGAGACAAGGAGG + Intronic
946189145 2:217998512-217998534 AGCAAGGCCCAGGGCCATGGAGG - Intronic
946223621 2:218250001-218250023 GCCAGTGCCCAGATACATGGAGG - Intronic
946361614 2:219222378-219222400 TCCACTGCCCAGAGACCTGCAGG - Exonic
946458335 2:219847931-219847953 AGAACTGCTCAGGGACATTGTGG + Intergenic
946736131 2:222756458-222756480 AACACTGCACAAAGGCATGGAGG - Intergenic
948768546 2:240235651-240235673 AGACCTGCCCAGACACAGGGCGG - Intergenic
1169154239 20:3315894-3315916 AGCACTGGACATGGACATGGTGG - Intronic
1169313181 20:4565513-4565535 AGCAAAGCCAAGAGCCATGGAGG + Intergenic
1170913445 20:20598610-20598632 AGCAATGCCCAGAGGCAAGCGGG + Intronic
1171386087 20:24770250-24770272 AGCACGGGCCAGAGACCTGCAGG + Intergenic
1172351963 20:34250105-34250127 ACCAATGGCCAGAGACCTGGGGG - Intronic
1172872292 20:38143297-38143319 ACCAAGGCCCAGAGACATGAAGG - Intronic
1178082472 21:29079299-29079321 AGCAGTGCCAAGAGACAGGAAGG + Intronic
1178294017 21:31393468-31393490 AACACGCCCAAGAGACATGGAGG + Intronic
1178349999 21:31866113-31866135 AGCCCTGCCCAGGGCCACGGAGG + Intergenic
1178580868 21:33837050-33837072 ATCACTGCCCAGAGGGATGATGG + Intronic
1179590362 21:42404062-42404084 AGTACTGCCCAGAGACCCCGGGG + Intronic
1180483045 22:15773079-15773101 AGCCCTCCTCAGAGACGTGGGGG - Intergenic
1180759927 22:18193615-18193637 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1180770239 22:18377914-18377936 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1180775741 22:18431085-18431107 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1180776091 22:18484752-18484774 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1180808814 22:18742122-18742144 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1180828180 22:18880870-18880892 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1181050027 22:20234113-20234135 AGCTGTGCCCAGGGGCATGGGGG - Intergenic
1181071743 22:20347096-20347118 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1181194812 22:21176038-21176060 AGCAGTGCCCAGGAACAAGGAGG - Intergenic
1181214633 22:21316732-21316754 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1181525035 22:23477974-23477996 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1182010698 22:26998539-26998561 ACCAATGCCCAGAGCCCTGGAGG + Intergenic
1183417410 22:37690606-37690628 ACCACTTGCCAGAGCCATGGTGG + Intronic
1183636548 22:39066987-39067009 GCCACTGCACAGAGACATGTGGG + Intronic
1185182468 22:49371407-49371429 GCCTCTGCCCTGAGACATGGTGG + Intergenic
1203232071 22_KI270731v1_random:119098-119120 AGCAGTGCCCAGGAACAAGGAGG + Intergenic
1203237363 22_KI270732v1_random:18029-18051 AGCTCAGCTCAGACACATGGAGG - Intergenic
949500053 3:4671176-4671198 AGCATGGCCCATAGATATGGTGG + Intronic
950091874 3:10301461-10301483 ACCACTGCCCAGAGGCTTGTGGG + Intronic
952198594 3:31101926-31101948 AGAACTTCCCAGAGCCTTGGAGG - Intergenic
953883183 3:46701877-46701899 AGCCCTGCCCAGACTGATGGGGG + Intronic
954038963 3:47869875-47869897 AGCACAGCCCAGAGGCCTGCTGG + Intronic
955015279 3:55064077-55064099 AGCCCTGCCCAGTTACCTGGTGG + Intronic
958636156 3:96750137-96750159 AGCCCTGCCCAGAGGGATGGGGG - Intergenic
958751254 3:98194940-98194962 ACCACTGCACGGAGACATGATGG - Intronic
960478450 3:118159344-118159366 GGTACTTCCTAGAGACATGGAGG - Intergenic
961192591 3:124974473-124974495 AGCACTGCCCGGAGAGTTGGAGG - Intronic
961881262 3:130062897-130062919 GCCACTGCACAGAGACATGATGG - Intergenic
962458104 3:135583886-135583908 AGCACTGAGCAGTGCCATGGGGG - Intergenic
962871248 3:139494724-139494746 GGCAATTCCCAGATACATGGTGG - Intergenic
963982537 3:151555807-151555829 GACACAGGCCAGAGACATGGGGG - Intergenic
965336583 3:167435060-167435082 GCCACTGCACAGAGACATGACGG - Intergenic
966086178 3:176068987-176069009 GGGACTGGCCAGAGACCTGGTGG + Intergenic
967184629 3:186933983-186934005 AGCACAAGACAGAGACATGGAGG - Intronic
967731548 3:192911747-192911769 GCCACTGCCCAGAACCATGGAGG + Intronic
967986792 3:195101171-195101193 AGCACTGGCAAGAGGCCTGGCGG - Intronic
969310096 4:6348002-6348024 CGCACTGCCCCCAGACATCGTGG - Exonic
969960406 4:10939512-10939534 AGAACTTCCTAGAGACTTGGAGG + Intergenic
972056288 4:34806908-34806930 AGAACTTCCTAGAGACTTGGAGG - Intergenic
972746190 4:41935063-41935085 AGCGGTGCCCAGAGGCATGACGG - Intergenic
973283150 4:48382589-48382611 AGAACTGCGCCGAGACGTGGTGG - Exonic
973714200 4:53658777-53658799 AGCATTGCACAGAGCCTTGGAGG - Intronic
976283449 4:83347686-83347708 GGAACTTCCCAGAGACTTGGAGG - Intergenic
976850750 4:89542126-89542148 AGAACAGCCCAGAGACAGGTTGG + Intergenic
980242303 4:130192161-130192183 AGAACTTCCTAGAGACTTGGAGG - Intergenic
980754637 4:137141688-137141710 TGCACTGCCCCTACACATGGGGG + Intergenic
985622245 5:961765-961787 GGGACGGCCCAGAGACAAGGAGG - Intergenic
986368702 5:7060016-7060038 GCCACTGCACAGAGACATGATGG + Intergenic
986616205 5:9619826-9619848 AGCAGAGGCCAGAGACTTGGGGG - Intergenic
986735438 5:10664404-10664426 ATCACTGCCCAGAGGGATGATGG - Intergenic
988661007 5:33268530-33268552 AGGGCTGCCAAGAGAAATGGTGG + Intergenic
994637934 5:102365401-102365423 AGAAATGCAAAGAGACATGGTGG + Intergenic
995037057 5:107546059-107546081 TTCACTGCCCAGAGAGATGGGGG + Intronic
995347431 5:111136581-111136603 AGCACTGCCCAGAGACAGTTAGG + Intergenic
997705973 5:135952881-135952903 AGTACTGTCCACAGCCATGGCGG + Exonic
1000517298 5:162254189-162254211 AGCAATGTCAAAAGACATGGAGG - Intergenic
1000519190 5:162277483-162277505 GCCACTGCACAGAGACATGATGG + Intergenic
1001953458 5:175832025-175832047 AGCACAGACAAGAGACATGGAGG - Intronic
1003424675 6:5990378-5990400 ATCCCTGTCCAGAGACATGATGG - Intergenic
1003767965 6:9262087-9262109 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1004575434 6:16889576-16889598 GCCACTGCACAGAGACATGATGG - Intergenic
1006929891 6:37681186-37681208 AGCCCTGACCTGAGACAGGGAGG - Intronic
1008492638 6:52102303-52102325 AGCAGTAGCCAGAGGCATGGAGG + Intergenic
1009310602 6:62147437-62147459 AGCAATGCCCAGTGACTTGTGGG - Intronic
1011382580 6:86758965-86758987 GGAACTTCCCAGAGACTTGGAGG + Intergenic
1011913363 6:92470049-92470071 AGCTCTGCTCAGAGAAATTGGGG + Intergenic
1011948409 6:92935335-92935357 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1012860188 6:104550218-104550240 GGCTCTGCCCTGAGACATGATGG + Intergenic
1013414950 6:109916766-109916788 AGCACACCTCAGAGACATTGTGG - Intergenic
1013599291 6:111689457-111689479 AACACAGCCCAGAGAGATGAGGG + Intronic
1014389549 6:120843733-120843755 AGCACTTCACAAAGACAAGGTGG - Intergenic
1015264974 6:131281741-131281763 GGCTTTGCACAGAGACATGGGGG - Exonic
1016688907 6:146912998-146913020 AGCACTTCCAGGAGACAGGGAGG - Intergenic
1017815621 6:158014604-158014626 AGTCCTGCCTAGAGAAATGGAGG + Intronic
1018032999 6:159858492-159858514 AGCACTGCCCAGGGACCTGAGGG - Intergenic
1018069213 6:160147007-160147029 ACCACTGCTCAGAGAGCTGGTGG + Intronic
1018489618 6:164278854-164278876 AGAACTTCCTAGAGACTTGGAGG + Intergenic
1019549140 7:1593621-1593643 AGCACCGCCCTGAGGCAAGGTGG - Intergenic
1020260282 7:6527021-6527043 TGCAGTGGCCAGAGTCATGGAGG - Intronic
1020316264 7:6907409-6907431 GCCACTGCACAGAGACATGATGG - Intergenic
1022191109 7:28017660-28017682 AGCACTGGCCAGATACTTGTGGG + Intronic
1022627297 7:32051005-32051027 AGCACAGCCCAGAGGCAGGCTGG + Intronic
1022744115 7:33152036-33152058 AGGACAGAACAGAGACATGGAGG - Intronic
1023605065 7:41922838-41922860 AGTTCAGCTCAGAGACATGGAGG + Intergenic
1023905040 7:44516084-44516106 CGCACTTCCCATAGAGATGGTGG + Exonic
1028133738 7:87205779-87205801 GGCACTTCCTAGAGACTTGGAGG - Intronic
1028572531 7:92306557-92306579 AGTAGTGCACAGAGACATGGTGG + Intronic
1031696112 7:124857281-124857303 AGCTCTGCAAAGAGACATTGTGG + Intronic
1031837821 7:126699981-126700003 ATCACTGCACAGGGAGATGGAGG + Intronic
1033602288 7:142896952-142896974 ATCACTGACCTGAGACCTGGGGG + Intergenic
1033777466 7:144628713-144628735 AGAACTTCCTAGAGACTTGGAGG + Intronic
1034529045 7:151684088-151684110 TGCACTGCCCAGAGCCATTCTGG - Intronic
1034904129 7:154929095-154929117 AGCACTCCCAAGTGCCATGGGGG + Intronic
1035695297 8:1591387-1591409 AGCAGTGACCAGAGACCAGGAGG - Intronic
1037635445 8:20697873-20697895 ACCACTGCCGAGAGAGATGTGGG + Intergenic
1040627132 8:49161706-49161728 AACACTGGCCAATGACATGGAGG + Intergenic
1043345725 8:79296050-79296072 GGAACTTCCCAGAGACTTGGAGG + Intergenic
1044233867 8:89808366-89808388 AGAACTTCCCAGAGACTTGGAGG + Intergenic
1044696011 8:94922936-94922958 ATCACGGCCATGAGACATGGAGG - Intronic
1045174192 8:99703746-99703768 AGCACTTTCCAGAGGCAGGGTGG + Intronic
1048808857 8:138266676-138266698 AGCACTGCCCAGGGTTATTGTGG + Intronic
1049412764 8:142480839-142480861 AGCCTGGCCCAGAGACATGGGGG - Intronic
1049790223 8:144469034-144469056 AGCATTGCCCAGAAGCACGGAGG + Intronic
1051639818 9:19214218-19214240 AACAATGACCAGAAACATGGAGG + Intergenic
1052054061 9:23883414-23883436 GGAACTTCCCAGAGACTTGGAGG - Intergenic
1052233981 9:26188528-26188550 AGAACTGCCCAGAGCCAGGTAGG + Intergenic
1055885859 9:81062674-81062696 GGAACTTCCCAGAGACTTGGAGG + Intergenic
1056723249 9:89089505-89089527 AGCACTGCCCTTAGGCAAGGGGG + Intronic
1057222109 9:93263007-93263029 GGCAGTGCCCAGAGACTAGGAGG + Intronic
1058702611 9:107613400-107613422 AGCACTGACCAGACACCTGGAGG + Intergenic
1060145205 9:121246970-121246992 AGCAATTCCCAGAGACGTGTAGG + Intronic
1060733829 9:126053852-126053874 ATCACTGCCAAGGGGCATGGTGG - Intergenic
1060763954 9:126279930-126279952 AGCAATGCACAGAGCCAAGGAGG + Intergenic
1060833955 9:126740875-126740897 AGCACTTAACAGAGACAAGGTGG - Intergenic
1061330653 9:129890301-129890323 AGGACTGACCCGAGCCATGGGGG + Exonic
1061423464 9:130484635-130484657 ACCACTGCGCAGAGAGAAGGAGG - Intronic
1062134456 9:134917584-134917606 GGCATTGCCCAGGGTCATGGAGG - Intronic
1062303414 9:135888515-135888537 GGCACAGCCCAGAGACGTGCAGG + Intronic
1062312145 9:135944639-135944661 GGCCCTGCCCAGAGACCGGGAGG - Intronic
1062523936 9:136970717-136970739 TGCAGGGCCCAGGGACATGGTGG + Intronic
1203581390 Un_KI270746v1:9185-9207 AGCTCAGCTCAGACACATGGAGG - Intergenic
1189468795 X:41298366-41298388 AGCACCGCCCAGATAACTGGGGG + Intergenic
1189940740 X:46117932-46117954 AGAGCTGCCTAGAGAAATGGTGG - Intergenic
1190565761 X:51729100-51729122 AGCCTTGTCCAGAGCCATGGGGG - Intergenic
1191761557 X:64652906-64652928 GCCACTGCACAGAGACATGATGG - Intergenic
1193552592 X:82915230-82915252 AGGGGTGCCCAGAGAGATGGAGG - Intergenic
1194545777 X:95231683-95231705 ATCTCTGCCCAGAGACTTAGTGG - Intergenic
1194850123 X:98859190-98859212 AGGACTTCCTAGAGACTTGGAGG + Intergenic
1198228297 X:134666719-134666741 ATCATTGCCCAGGGAAATGGTGG - Intronic
1200544536 Y:4503528-4503550 GGCACTGCCCAGGAACATGAAGG - Intergenic
1201307273 Y:12561826-12561848 GCCACTGCACAGAGACATGATGG + Intergenic
1201581589 Y:15516009-15516031 GTCACTGCACAGAGACATGATGG - Intergenic
1201784251 Y:17757199-17757221 AGCAATGCCTGGATACATGGTGG + Intergenic
1201817302 Y:18148788-18148810 AGCAATGCCTGGATACATGGTGG - Intergenic
1202076269 Y:21040792-21040814 GCCACTGCACAGAGACATGATGG + Intergenic