ID: 1076701424

View in Genome Browser
Species Human (GRCh38)
Location 10:132275211-132275233
Sequence GGCAGCACTGCCCAGAGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 453
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 416}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701424_1076701434 16 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701424_1076701426 -7 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701426 10:132275227-132275249 TGCTGCCCCACCAGGCCCCATGG No data
1076701424_1076701437 27 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701424_1076701441 30 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701424_1076701436 24 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701424_1076701438 28 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701424_1076701439 29 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701424_1076701435 17 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701424 Original CRISPR GGCAGCACTGCCCAGAGACA TGG (reversed) Intronic
900218194 1:1493252-1493274 GGAAGCTCTGGCCAGAGATATGG - Intronic
900317013 1:2061949-2061971 GGCAGCACTGCCCAGGCTGAGGG + Intronic
900438269 1:2641502-2641524 GGCAGCACTGCCCGCGGAGAAGG + Exonic
901035976 1:6336527-6336549 GGCAGCACAGCCCAGGTAAAGGG + Intronic
901175716 1:7297551-7297573 GGCAGAACTGCCCACATGCAGGG - Intronic
901620864 1:10585745-10585767 TGCACCACTGCATAGAGACAGGG - Intronic
901740524 1:11338912-11338934 GGACGCACTGCCCAGGGCCACGG + Intergenic
901823757 1:11847282-11847304 GTCAGCCCAGCCCAGAGAGATGG - Exonic
902374017 1:16021835-16021857 GGCAGAACTGCCAAGAGAGAAGG - Intronic
902516717 1:16993582-16993604 GGCCCCACTGCCCAGAGGCAGGG + Intronic
902552906 1:17229854-17229876 GGCAGTGGTGCCCAGAGGCAGGG - Intronic
902688094 1:18091915-18091937 GCCAGCACTGCAAAGAGCCAGGG - Intergenic
902845088 1:19104062-19104084 GGTAGCACTGCCCAGTGGCCTGG - Exonic
903315036 1:22496704-22496726 GGAAGCATTGCTGAGAGACAGGG - Intronic
903968066 1:27102069-27102091 GCCAGCACTGTCCAAGGACAAGG - Exonic
905396072 1:37667490-37667512 GTCTGCCTTGCCCAGAGACAGGG - Intergenic
905496204 1:38389944-38389966 GGCAGCACTGCCCAAGGCCTTGG - Intergenic
905541353 1:38762999-38763021 GGCAGCACTGGCCTTACACAGGG + Intergenic
906279378 1:44542979-44543001 AGCAACACTGCCGAGAGACAGGG - Intronic
906405172 1:45536224-45536246 GTCAGCTCTGCCTAGAGGCAGGG + Intergenic
907668399 1:56452810-56452832 GCCAGCAATGGCCAGAGGCAGGG + Intergenic
909831897 1:80202608-80202630 GGCAGGGCTGCGTAGAGACATGG - Intergenic
910725036 1:90328874-90328896 GGCAGCTCAGCACAGAGAGAGGG + Intergenic
911865239 1:103010581-103010603 GGCAGCAATGAGCAGAAACAAGG - Intronic
912549935 1:110479037-110479059 GGAAGCACTGCTCAGAGGCAGGG + Intergenic
914904844 1:151735414-151735436 AGCAGCACTGCCCAGGGCTAAGG - Intergenic
915274065 1:154776040-154776062 GGCAGCTCTGCCCAGCGAGACGG + Intronic
915723632 1:158002297-158002319 GTCTACACTGCCCAGAGTCAAGG + Intronic
915828374 1:159102594-159102616 GGCAGAGCTGCCCAAAGCCATGG + Intronic
916714274 1:167436010-167436032 GGCAGCACTGCCCTTACACCAGG + Intronic
917682746 1:177384600-177384622 GGAAGCCCTGCCCAGTGAGAAGG + Intergenic
918152411 1:181809294-181809316 GGAAGCAGTGCCCCGAGGCATGG - Intergenic
918515489 1:185358574-185358596 GGGAGAACTGCCCAGAGAATTGG + Intergenic
920506031 1:206516204-206516226 AGGAGCACTACCTAGAGACAGGG - Intronic
921348795 1:214214423-214214445 GTCAGCACTGACCAGAGCTAGGG - Intergenic
922192102 1:223328404-223328426 GGCAACCCTGCCCAGAGAATTGG - Intronic
922392133 1:225155755-225155777 GGCAGCACAGACTAGAGAGAAGG - Intronic
922481650 1:225943465-225943487 GCCAAAACTGCCCAGAGGCATGG - Intergenic
922949814 1:229549271-229549293 GGCAGCACCACACAGAAACACGG + Exonic
923102455 1:230827237-230827259 GCCAGCACTGCCATTAGACATGG + Intergenic
923105040 1:230847960-230847982 GGCAGCAGTGGGCAGAGCCAGGG + Intronic
923217135 1:231858725-231858747 TACAGCACTCCCCAGAGAAACGG - Intronic
923766876 1:236900800-236900822 GCCAGCAGTGCCCAGATACCAGG + Exonic
924125446 1:240845912-240845934 GGCAGCAGTGGCCAGAGATGAGG - Intronic
924474334 1:244369958-244369980 GGCAGCTGTGCCCATAGAAAAGG - Intronic
924573151 1:245256489-245256511 AGCAGCACTGGCCAGGGGCAAGG - Intronic
1062759964 10:10876-10898 GCCGGCTCTGCCAAGAGACATGG + Intergenic
1063103314 10:2970360-2970382 CCCAGCACTGCACAGAGCCATGG - Intergenic
1063450300 10:6145905-6145927 CCCAGCACTGCCCAGAGCCCTGG + Intronic
1064112356 10:12550121-12550143 GGCAGCAGTGACCACAGCCAAGG - Intronic
1064310518 10:14208348-14208370 GACAGCCCTCCCCAGAGACCTGG - Intronic
1067109104 10:43386837-43386859 GGCAGCTATGTCCAAAGACAGGG - Exonic
1067170140 10:43899293-43899315 GGCAGCCCTGCCCAGATCCCAGG + Intergenic
1067227707 10:44386336-44386358 GCCAGGACTCCCCAGGGACAGGG - Intronic
1067347495 10:45447052-45447074 GGAAGCACCTTCCAGAGACATGG - Intergenic
1067440735 10:46308048-46308070 GGCCAAACTGCCCAAAGACATGG - Intronic
1067527179 10:47045922-47045944 ACCAGCACTGCTCAGAGTCATGG + Intergenic
1068312176 10:55292767-55292789 GGCAGAACTGCCCAAGGCCATGG - Intronic
1069850401 10:71400383-71400405 GGCAGCTCTGCCAGGGGACAAGG + Intronic
1070572047 10:77647284-77647306 GGCTGCAGTGCTCAGAGAAACGG - Intergenic
1071693903 10:87852399-87852421 GGCAGAACTGACCTGAGAGAAGG + Intergenic
1075025095 10:118978517-118978539 GGCAGCATTGCAGCGAGACACGG - Intergenic
1076520527 10:131078213-131078235 CCCAGCACTGCCCAGAGCCCAGG + Intergenic
1076645196 10:131948925-131948947 GCCAGCACTGCCCTGAGAAGTGG + Intronic
1076701424 10:132275211-132275233 GGCAGCACTGCCCAGAGACATGG - Intronic
1076719213 10:132385869-132385891 CGCAGCACTGGCCAGAGAGCAGG - Intergenic
1076838582 10:133033458-133033480 GCCAGCTCTGCCCAGAGATGCGG + Intergenic
1077476462 11:2792684-2792706 GGAGGCACTGGCCAGAGCCACGG + Intronic
1077886914 11:6393548-6393570 GGCAGCCCTGGCTAGAGAAAGGG - Intronic
1078098383 11:8313996-8314018 GGCAGCACTGCTCAGAGTCTCGG + Intergenic
1078759008 11:14236738-14236760 GGCAGCAAGTCCCAGAGCCAAGG + Intronic
1078952797 11:16153972-16153994 GGCAGCATTACCCAAAGCCATGG - Intronic
1079279108 11:19072243-19072265 GGAAGCACTGGGCAAAGACACGG + Intergenic
1079986137 11:27202635-27202657 GGAAGCCCTACCCAGACACATGG - Intergenic
1081601761 11:44500330-44500352 GGCTGCACTGCCAAGAAACCAGG - Intergenic
1081666310 11:44918934-44918956 TGCAGCTCTGCCCAGAGGGAGGG - Intronic
1081742082 11:45447989-45448011 ACCAGGACTGCCCAGGGACAGGG + Intergenic
1082934233 11:58639788-58639810 GGCAGCACTGGCCAGAGGAATGG + Intergenic
1083223510 11:61268937-61268959 GGCAGCACTGTCCAGGGATCCGG + Exonic
1084181392 11:67448348-67448370 GGGAGCCCTGCCCAGAAAAAGGG + Intergenic
1084235140 11:67782835-67782857 AGCTGTACTGCCCAGAGTCATGG + Intergenic
1084242226 11:67829738-67829760 TGGATCACCGCCCAGAGACAAGG - Intergenic
1084467698 11:69335876-69335898 GGCGGCACTGCCAAGCCACATGG - Intronic
1084506958 11:69574490-69574512 CCCAGCCCAGCCCAGAGACAGGG + Intergenic
1086348902 11:85925064-85925086 GGATGCCCTGCCCAGAGAGAAGG - Intergenic
1086933768 11:92722387-92722409 GGCAGAGCTGCCCAGGGCCATGG - Intronic
1087877532 11:103375536-103375558 GGCAGAGCTGCCCAGGGCCATGG + Intronic
1088622819 11:111704093-111704115 GGCAGCACAGCCCGGAGCCTTGG - Intronic
1089307382 11:117535238-117535260 GGCAGCAGCTCACAGAGACAGGG - Intronic
1089539678 11:119182294-119182316 GGCAGCTCTGGCCAGGGCCAGGG - Exonic
1089540474 11:119186601-119186623 GGCACCTCTGCCCAGCGCCAGGG + Exonic
1089645414 11:119875664-119875686 TGCAGCCCTTCCCAGGGACACGG + Intergenic
1089924378 11:122242225-122242247 GGCAGCACTGTCCTGGTACAGGG + Intergenic
1089974040 11:122717195-122717217 GAAAGCAAGGCCCAGAGACATGG + Intronic
1090048796 11:123359221-123359243 GGCAGCACTGCCCAGAACAAGGG - Intergenic
1090435596 11:126684118-126684140 GGCAGGGCTGCCCAGAGCCCTGG + Intronic
1091048913 11:132350499-132350521 CTCAGCACTGGCTAGAGACAGGG - Intergenic
1091656264 12:2348796-2348818 GGCTGGACTTCCCAGACACAGGG + Intronic
1092089790 12:5795046-5795068 GGAAGCAGAGCCCAGAGACAAGG + Intronic
1092135006 12:6140869-6140891 GGCAGGGCTGCTCAGAGGCAGGG + Intergenic
1092412475 12:8264437-8264459 TGGATCACCGCCCAGAGACAAGG - Intergenic
1092479870 12:8850229-8850251 GCCAGTACTTCCCAGAGACCTGG + Exonic
1092593710 12:9976332-9976354 AGCAGAGCTGCCCAAAGACATGG + Intronic
1096467549 12:51855789-51855811 GAGAGCACTGCCCAGAGGCCTGG - Intergenic
1097191634 12:57222227-57222249 GGCGGGACTGCCCAAAGCCAGGG + Intronic
1098628299 12:72699534-72699556 GGCAGAACTGCCCAAAACCATGG - Intergenic
1099046363 12:77725878-77725900 GGAAACACAGCCAAGAGACAGGG - Intergenic
1101726419 12:107392168-107392190 GGCAGGGATGCCCAGAGAAAGGG - Intronic
1104036546 12:125101362-125101384 TGCAGTACAGACCAGAGACATGG + Intronic
1104828713 12:131733521-131733543 GGCTCCACTGCTCAGAGGCAAGG - Intronic
1105227385 13:18448645-18448667 GGCAGAACTGCCCAAGGCCATGG + Intergenic
1105407580 13:20144701-20144723 AGCAGCAGTGCCCACAGACACGG + Intronic
1106346825 13:28887361-28887383 GGCAGCTGTGGTCAGAGACATGG - Intronic
1108290050 13:48950084-48950106 GGGAGAACAGCCCAGAGGCAAGG + Intergenic
1108576999 13:51799397-51799419 GGCAGCTGTGCCCAGAACCATGG + Intronic
1108796123 13:54033126-54033148 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1109189480 13:59307799-59307821 GGCAGAACTGCCCAAGGCCACGG - Intergenic
1109667541 13:65558852-65558874 GGCAGAACTGCCCAAGGCCATGG - Intergenic
1110709022 13:78629493-78629515 GGCACAACTGAACAGAGACATGG + Intronic
1112766467 13:102751028-102751050 GGCAGTGATGCCCAGAGATATGG + Intronic
1113778474 13:112962529-112962551 GGCTGCACTGGCCAGGGACCAGG - Intronic
1113987928 13:114333920-114333942 AGCAGCATTGCCGAGAGCCAGGG + Intergenic
1114064558 14:19050460-19050482 GACAGCCCTCCTCAGAGACATGG - Intergenic
1115651003 14:35403228-35403250 GGCAGCCCTGCTCACAGGCAAGG + Exonic
1116364134 14:44039284-44039306 TACAGAGCTGCCCAGAGACATGG + Intergenic
1116780922 14:49236640-49236662 GGCAGAGCTGCCCAAAGTCATGG + Intergenic
1118526738 14:66652964-66652986 GGGAGAACTGCCCAGAGAATAGG - Intronic
1119194603 14:72708241-72708263 GGCAGGACTGGCCAGAGGCAGGG - Intronic
1119437800 14:74609580-74609602 TGTAGCACTGCCCAAGGACAAGG - Intronic
1119545482 14:75468669-75468691 GGAAGCTTTGCCCACAGACAGGG - Intronic
1121329553 14:93041340-93041362 GGCAATACTGTGCAGAGACAGGG - Intronic
1121925465 14:97923349-97923371 GGAAGCCCTGCCCATAAACAGGG - Intergenic
1122238650 14:100347346-100347368 GGGAGCAGTGGCCAGAGACTAGG - Intronic
1202860751 14_GL000225v1_random:79667-79689 GGAAGAGCTGGCCAGAGACACGG - Intergenic
1123599511 15:21952778-21952800 GGCATCACTGCCCACAGCCGGGG + Intergenic
1124632002 15:31343347-31343369 GGATGCAGTGCCCACAGACAAGG + Intronic
1124881595 15:33647826-33647848 CCTAGCACTGCACAGAGACATGG - Intronic
1125144450 15:36450691-36450713 GGCAGCTGTTCCCAGAGAGAAGG - Intergenic
1125298037 15:38223554-38223576 GGGAGCACTGTAGAGAGACAAGG + Intergenic
1125584380 15:40809883-40809905 CCCAGCACTTCCCAGAGCCAGGG + Exonic
1125610892 15:40969531-40969553 GGCACCACTGCCAACAGAGAAGG - Intergenic
1126029843 15:44485752-44485774 TGCTGCACTGGGCAGAGACAAGG - Intronic
1126079514 15:44945696-44945718 GGATGCAGTGCCCAGAGACAAGG + Intergenic
1129270358 15:74416196-74416218 GCCAGCAGTGCCCAGGGTCAGGG + Intronic
1129385009 15:75191604-75191626 AGCAGCACTGGCCAGGGAGAGGG - Intergenic
1129946130 15:79540723-79540745 GGCAAGACTGCCCAAAGCCAAGG + Intergenic
1130032256 15:80326822-80326844 CAGGGCACTGCCCAGAGACAGGG - Intergenic
1131110600 15:89762109-89762131 AGCAGCACTGCCCACACACCTGG - Intronic
1132592364 16:731528-731550 GGCCGCTCTGCCCAGAGATCTGG + Intronic
1133067783 16:3221565-3221587 GGCAGCCCTGCCCAGAGTCGGGG - Intergenic
1133353743 16:5120677-5120699 TGGATCACCGCCCAGAGACAAGG - Intergenic
1134805064 16:17117551-17117573 GGCAGCACTGCTCAGACATAGGG - Intronic
1135988581 16:27203015-27203037 TGCAGCATTGCACAGAGGCATGG - Intergenic
1136531917 16:30875537-30875559 GCGAGCACAGCCCTGAGACAAGG + Intronic
1137856336 16:51797972-51797994 GGCAGAGGTGCCCAGAGAGAGGG - Intergenic
1138113200 16:54340534-54340556 GCCACCACTTCCCAGAGCCAGGG - Intergenic
1138418280 16:56883940-56883962 GCCAGCAGTGCCCAGAGCCGGGG - Intronic
1139630996 16:68231861-68231883 GGCTGCACTGCGCAGGCACAAGG - Exonic
1139965332 16:70742133-70742155 GGCAGCACAGCCTTGTGACAGGG - Intronic
1141161594 16:81632801-81632823 GGAAGCCCTGGCCAGGGACAGGG - Intronic
1141273116 16:82558631-82558653 GGCAGAACTGCCCAAGGCCATGG + Intergenic
1141559137 16:84855032-84855054 AGCCCCACTGCCCCGAGACATGG + Intronic
1141884224 16:86880782-86880804 GGCAGGACTGCCCAGGGGTAGGG + Intergenic
1142029656 16:87832220-87832242 GGCCACACTGCCCAGAGGCCAGG + Exonic
1142143278 16:88482106-88482128 GGCATCACTGGGCAGAGAGAGGG + Intronic
1142993106 17:3745098-3745120 GGCAAAGGTGCCCAGAGACATGG - Intronic
1143012026 17:3871200-3871222 GGCAACAAGGCCCAGAGACAGGG + Intronic
1143203611 17:5128706-5128728 GTCAGCAGGGCCCAGAGTCAGGG - Intronic
1144023985 17:11261376-11261398 GTCAGCACAGCCAAGAGAGAGGG - Intronic
1145943348 17:28755721-28755743 AGCAGCCCTGCCCAGGGAGAGGG + Intergenic
1146466129 17:33088210-33088232 AGCAGGACTGCGGAGAGACACGG - Intronic
1146857277 17:36264609-36264631 GTCAGCAGCGCCCAGAGTCAGGG + Intronic
1146873190 17:36388519-36388541 GTCAGCAGCGCCCAGAGTCAGGG + Intronic
1146929796 17:36768907-36768929 GGCAGCAATGTGCAGAGGCAGGG + Intergenic
1147066198 17:37924354-37924376 GTCAGCAGTGCCCAGAGTCAGGG - Intergenic
1147076072 17:37989144-37989166 GTCAGCAGCGCCCAGAGTCAGGG + Intronic
1147077731 17:38003915-38003937 GTCAGCAGCGCCCAGAGTCAGGG - Intronic
1147087597 17:38068690-38068712 GTCAGCAGCGCCCAGAGTCAGGG + Intergenic
1147093668 17:38127850-38127872 GTCAGCAGTGCCCAGAGTCAGGG - Intergenic
1147103539 17:38192639-38192661 GTCAGCAGCGCCCAGAGTCAGGG + Intergenic
1147121062 17:38335340-38335362 GGCAGCAATGGACAGAGACCAGG - Intronic
1147376030 17:40022964-40022986 GGGAGCTCTGGCCAGAGACTGGG - Intronic
1147384183 17:40071979-40072001 GGCTGCACTGCCCAGCACCAGGG + Intronic
1147488644 17:40843092-40843114 GGCAGCAGTGAACAGAGAGAAGG - Intergenic
1147770615 17:42865678-42865700 GGCAGCACCACACAGAGACCAGG - Intergenic
1148150078 17:45391684-45391706 GGCTGCCATGCTCAGAGACAGGG + Intergenic
1148191092 17:45679098-45679120 GGCAGGACTGGCCAGGGGCAAGG - Intergenic
1148237753 17:45980812-45980834 GCCAGAACTGACCAGAGGCAGGG - Intronic
1148652742 17:49261253-49261275 GGCAGAAATGCCCAGAGACCTGG + Intergenic
1149469187 17:56902206-56902228 GGCCTCAGTGCACAGAGACAAGG + Intronic
1149848114 17:60019136-60019158 GTCAGCAGCGCCCAGAGTCAGGG + Intergenic
1150086470 17:62275739-62275761 GTCAGCAGTGCCCAGAGTCAGGG + Intronic
1151140149 17:71983949-71983971 AGCAGGACTGCACAGAGCCATGG + Intergenic
1151175379 17:72283980-72284002 GGCAGGAAGGCCCAGAAACAGGG - Intergenic
1151802706 17:76387167-76387189 GGCACCACTGTCCAGTGAGAGGG - Exonic
1152073189 17:78144201-78144223 GGCAGCGCAGCCCAGAGAACTGG + Intergenic
1152206194 17:78975975-78975997 GGCAGCTCTGCCCAGAGCCTGGG + Exonic
1152503115 17:80726262-80726284 GGCAGCACGGCACAGGGCCATGG - Intronic
1152550144 17:81025523-81025545 GGCTCCAATGCCCAGAGACGAGG - Intergenic
1152597869 17:81246629-81246651 GGCAGCGGTGCCCAGAGGCCAGG - Exonic
1152697234 17:81803479-81803501 GACAGGACTGGCCAGAGACCGGG + Intergenic
1152760736 17:82105868-82105890 GGCAGGACTGCCCAGAGCCCTGG - Intronic
1152952872 18:11229-11251 GCCGGCTCTGCCAAGAGACATGG + Intergenic
1155307389 18:24492179-24492201 TGCAGAACTGCCCAGGGACCTGG + Intergenic
1158116976 18:54006124-54006146 GGCAGCTCAGCACAGAGAGAGGG + Intergenic
1158233869 18:55290409-55290431 GACAGCATTTCCCAAAGACAGGG - Intronic
1159816547 18:73080660-73080682 GGCAGCACTGGCCACAGGGAAGG + Intergenic
1160599464 18:80001569-80001591 GGCAGAACTGCCCAAGGCCATGG + Intronic
1160808700 19:1003605-1003627 GGCCGCACTGCCCAGCGCCCGGG - Exonic
1161766756 19:6212754-6212776 GGCAGCTCTGGGCAGAGACAGGG - Intergenic
1162002808 19:7758085-7758107 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
1162418501 19:10552561-10552583 GACAGCAGGGCCAAGAGACAGGG - Intronic
1162494760 19:11017524-11017546 GGCAGCAATTCCCAGTGAGAGGG - Intronic
1162800453 19:13107526-13107548 GCCAGGGCTGCCCACAGACATGG - Intronic
1162938891 19:13996332-13996354 GGCAGTACTGCCCGGAGTCATGG - Intronic
1163685065 19:18708020-18708042 GGCAGCCCTCCCAGGAGACATGG - Intronic
1163740561 19:19009323-19009345 GGAAGCACTGGCCAGAGAGCAGG + Intronic
1164513099 19:28913169-28913191 GGCAGCTCTGCAGAGAGACAGGG - Intergenic
1166299599 19:41906441-41906463 GACAGCACTGGCCAGGGGCAAGG - Exonic
1166354194 19:42217356-42217378 GGCAGTCCTACCCAGAGTCAGGG - Intronic
1166388439 19:42395505-42395527 GGAAGAGCTGCCCAGAGACGGGG + Intergenic
925112412 2:1347413-1347435 ACCAGCCCTGCCCAGAGACTAGG + Intronic
926231609 2:11008409-11008431 AGCAACAATACCCAGAGACACGG - Intergenic
926734562 2:16063104-16063126 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
927168251 2:20346777-20346799 GTCAGTACTGCCCAGGGAAATGG - Intronic
928374626 2:30764549-30764571 GGCAGCACTGACGAGAGGCTGGG + Intronic
928564254 2:32527468-32527490 GGCAGCAGTGAACAGAGGCATGG + Intronic
928618871 2:33069254-33069276 GGCATCAGTGCACAGAGCCAGGG - Intronic
928723047 2:34142488-34142510 GGCAGCTCTGCCCACAGCCCTGG - Intergenic
929556284 2:42927532-42927554 GTGGGCACTGCCCAGACACAGGG + Intergenic
929960970 2:46496186-46496208 GGCAGTACTGCCCTCAGACCTGG + Intronic
930492458 2:52092985-52093007 GGCAGTACTGCTCATAGCCATGG - Intergenic
930723197 2:54657768-54657790 GGCAGCAGTGCCAAGAGGTAAGG + Intronic
931145277 2:59509746-59509768 GGAAGCACTGCCAGGAGAGATGG - Intergenic
932092228 2:68816585-68816607 CTCAGCACTGCCCAGAGTCCTGG + Intronic
932215425 2:69963077-69963099 GGCAGGACTGTCCAAAGGCAGGG - Intergenic
932468309 2:71938162-71938184 GGCAGCACTGCTGAGTGTCAGGG - Intergenic
932853342 2:75209142-75209164 GGCAGCCCTCCCCAAAGACCTGG + Intergenic
933153742 2:78947573-78947595 GGCAGCCATGTCCAGAGACGTGG - Intergenic
933273471 2:80258879-80258901 CGCCTCACTTCCCAGAGACATGG + Intronic
933341540 2:81032976-81032998 GGCAGCTCAGCACAGAGAGAGGG - Intergenic
933864097 2:86500291-86500313 GGCAGAGCTGCCCAGAGCCTTGG - Intergenic
934857656 2:97739151-97739173 GGCAGAGCTGCCCACACACAGGG - Intronic
934858497 2:97743936-97743958 TGCAGAGATGCCCAGAGACAAGG - Intergenic
935735135 2:106100492-106100514 GCCAGAACTGTCCAAAGACAGGG + Intronic
936109514 2:109653462-109653484 AGCAGCACTGCCAGCAGACAAGG - Intergenic
937844646 2:126566169-126566191 GGCAGCACTGCAAGGAGAGAGGG + Intergenic
941390657 2:164909810-164909832 GGCAGCACAGCTTAGAGAGATGG - Intronic
941405027 2:165076548-165076570 GGCAGCACTCTACAGATACATGG - Intergenic
942767378 2:179472795-179472817 AGCAGCCCTGCCTGGAGACAGGG - Intronic
946152690 2:217787219-217787241 GGCAGCTTTGCCCACAGGCACGG - Intergenic
946422885 2:219574922-219574944 GGGAGCATGGCCCAAAGACATGG - Exonic
946475190 2:220000332-220000354 GGCAGCACCTCCCAAACACAAGG + Intergenic
946814026 2:223557507-223557529 GCCAGGACTGCCCAGAGCAAAGG - Intergenic
947403776 2:229753905-229753927 GTCAGCACTGTTCAGAGAGAAGG + Intergenic
947924393 2:233908469-233908491 AGCAGCAGTGACCAGAGAAATGG + Intergenic
948420569 2:237857927-237857949 GCCAGCACAGCCCTGGGACAGGG - Intergenic
948948664 2:241235082-241235104 CGGGGCACTGCCCAGAGCCATGG - Intronic
948992889 2:241563712-241563734 GTCAGGACTGCCTGGAGACAAGG - Intronic
1171373538 20:24676586-24676608 GGCAGCCCTGGCCAGTGACCAGG + Intergenic
1171780304 20:29411207-29411229 GGAAGAACTGGCCAGAGAGACGG - Intergenic
1172393589 20:34583351-34583373 TGCAGCACTGCACAGGGACTGGG + Intronic
1178668369 21:34568492-34568514 GGCAGCGATGCCCGGAGTCACGG + Intronic
1179187314 21:39094819-39094841 GGCAGCACATAACAGAGACAGGG + Intergenic
1179270935 21:39850564-39850586 GAAAGCACTGCCCACAGCCAGGG - Intergenic
1179904982 21:44418177-44418199 GGCAGCTCTGCCCAGAACCCTGG + Intronic
1180245253 21:46542925-46542947 GCCAGCACCACCCACAGACAGGG - Intronic
1180866910 22:19124890-19124912 GGGAGCCCTGCCCAAGGACATGG + Intergenic
1181011064 22:20040890-20040912 GGCAGCACATCCCTGAGACCTGG + Intronic
1181030246 22:20146028-20146050 GGCAGCACAGCACACAGACACGG - Intronic
1181283638 22:21736568-21736590 GGGAGCACTACCCAGAGGAAGGG - Intergenic
1181694285 22:24585228-24585250 GGCTGCACAGACCAGAGGCAGGG - Intronic
1182366381 22:29782176-29782198 GGCAGCTCTGCCAAGAGAGTGGG + Intergenic
1184077741 22:42193883-42193905 CACCACACTGCCCAGAGACAAGG - Intronic
1184257320 22:43294648-43294670 GGGAGCACTTCCCAGGGATAAGG - Intronic
1184780397 22:46646168-46646190 GGTACCCATGCCCAGAGACAGGG - Intronic
949659833 3:6266147-6266169 AGCAGCAGTGAACAGAGACATGG + Intergenic
950524239 3:13514219-13514241 GGCCGCAGTGCCCAGAGGCTGGG + Intergenic
951541317 3:23784619-23784641 GGCAGCTCTGCACAGGGAGATGG - Intergenic
952853811 3:37751267-37751289 GTCAGCAGAGCCCAAAGACAAGG - Intronic
953515503 3:43587263-43587285 TACAGCACAACCCAGAGACAGGG + Intronic
953791508 3:45951348-45951370 GGCTGCACTACCTAGAGCCATGG + Intronic
954148676 3:48646922-48646944 GGCAGAACTGCCAGGAGAGAAGG + Exonic
954220919 3:49153439-49153461 AGCAACACTGCCCAGAGAGGAGG + Intergenic
955376873 3:58404673-58404695 GTGAGCACTGCCAAGAGCCATGG - Intronic
955508896 3:59659647-59659669 GGCTACACTGCCAAGACACAAGG - Intergenic
955573046 3:60328205-60328227 GGCAGGAATGAGCAGAGACAGGG + Intronic
955826363 3:62951762-62951784 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
955843264 3:63134601-63134623 GGCAGAATTTCCCAAAGACATGG - Intergenic
955945835 3:64192631-64192653 TCCAGTACTACCCAGAGACAGGG - Intronic
957057693 3:75456665-75456687 TGGATCACCGCCCAGAGACAAGG - Intergenic
958261904 3:91391838-91391860 GCCAGGACTGCCCAGAGTGAGGG + Intergenic
959717147 3:109444946-109444968 GGCAGCTCAGCACAGAGAGAGGG + Intergenic
959806505 3:110561464-110561486 GGTAGCTCAGCACAGAGACAGGG - Intergenic
960055305 3:113272737-113272759 GGCTGCACAGACCAGAGAGAAGG - Intronic
960375283 3:116893057-116893079 GTCAGCACCGCCCAAAGCCATGG - Intronic
961635347 3:128329605-128329627 GCCAGCTCTGCCCAGGCACAGGG + Intronic
961884784 3:130089364-130089386 AGCTGTACTGCCCAGAGTCATGG + Intronic
961890036 3:130123097-130123119 TGGATCACTGCCCAGAGACAAGG - Intergenic
962891139 3:139674025-139674047 GGCAGCTCTGGCCAGAGGCAGGG + Intronic
963516560 3:146316560-146316582 GGTGGCACTGCCCAGGGCCATGG - Intergenic
964241320 3:154597979-154598001 GGCAGCATTGTCTAGAGGCAGGG - Intergenic
966357830 3:179100755-179100777 GGCAGCCCTGTTCAGAGGCATGG + Intergenic
968448941 4:666168-666190 GGCTGCACTGCCCAGACACTCGG - Intronic
968568733 4:1328408-1328430 AGCAGCCCTGCCCCGAGACGGGG - Intronic
969000508 4:3977075-3977097 TGGATCACCGCCCAGAGACAAGG - Intergenic
969121872 4:4916813-4916835 GGCAGAACTGCCCAAGGCCATGG - Intergenic
969245568 4:5930557-5930579 GGAGGCACTGCTCAGACACATGG - Intronic
969343854 4:6559046-6559068 GGGAACACTGCGCTGAGACAGGG + Intronic
969623623 4:8291481-8291503 GTCAGCACTGCCCAGCGGGAGGG + Exonic
969753505 4:9131592-9131614 TGGATCACCGCCCAGAGACAAGG + Intergenic
969820003 4:9712924-9712946 AGCTGTACTGCCCAGAGTCATGG - Intergenic
969867641 4:10086036-10086058 GGCAGCCCTGCCAACAGAAACGG + Intronic
970410836 4:15806570-15806592 GGCAGCACTACCAGGAGAAAGGG - Intronic
971328883 4:25665949-25665971 GGCAGCACTGGGAAGAGGCATGG + Intronic
972739019 4:41873605-41873627 GGCTGCCCTGCCCAGGAACAGGG - Intergenic
973968965 4:56191670-56191692 GGCAGCACTGCCTGCAGTCAGGG + Intronic
974299175 4:60042175-60042197 GGCAGCTCTGCCCACAGCCCTGG - Intergenic
974389786 4:61251248-61251270 GTCAGCACAGCCCAGAAACCAGG - Intronic
977918211 4:102616503-102616525 GGCACCACTGGTCAGAGACTCGG - Exonic
978780889 4:112552758-112552780 GGAAGCACTGCCAAGTAACATGG - Intronic
982309149 4:153965837-153965859 GGAAGCACTGCTCATAGACCTGG + Intergenic
985469562 5:30894-30916 AGCAGCACTGCCGAGAGCCAGGG - Intergenic
985617135 5:929879-929901 GGCAGAACTGCCCAATGCCATGG + Intergenic
985650635 5:1105707-1105729 GGAAGTGCTGCCCAGGGACAAGG - Intronic
987114232 5:14713739-14713761 GGCAGCACATCCGAGAGCCAGGG + Intronic
987610730 5:20199274-20199296 GGCAGAGCTGCCCAAAGCCATGG + Intronic
988538250 5:32087672-32087694 GGCAGCAGTGCCCCGAGACATGG - Exonic
988557336 5:32248812-32248834 GTCAGCACTGCCCAAAGAACAGG - Exonic
989363976 5:40634915-40634937 GGATGCCCTGCCCAGAGAGAAGG - Intergenic
990401063 5:55437983-55438005 GGCAGCACTGTCTAAACACAGGG + Intronic
991214437 5:64146174-64146196 GTAGGCACTGCCCAGAGATAAGG + Intergenic
992227875 5:74636292-74636314 GCCAGCACTGCCCGGTGGCAAGG + Exonic
994092840 5:95824059-95824081 GACAGCTCTGTCCAGAGAAAAGG + Intronic
998105979 5:139469503-139469525 GGCAGCTCGGCTGAGAGACAAGG + Intergenic
999130300 5:149277901-149277923 GGAAGCAGTGCCCAGTGACCAGG - Intronic
1000578209 5:163002837-163002859 GGAAGCACTGCACAGAGCCCTGG + Intergenic
1001013696 5:168121488-168121510 GGTATCACTGACCAGAGAAAGGG + Intronic
1002137138 5:177114684-177114706 GGCAGCACTGCCCAGTGATGGGG - Intergenic
1003788072 6:9510351-9510373 AGGAGAACTGCCCAGACACAAGG - Intergenic
1004453674 6:15771070-15771092 CTCAGCAGTGACCAGAGACACGG - Intergenic
1004667484 6:17761872-17761894 GGAAGCACTGCCCATAGAAGAGG - Intronic
1005167152 6:22937990-22938012 GAAAGCACTGCCCAGACAGAAGG + Intergenic
1005924344 6:30429823-30429845 GGTAGCACTTCCCAAACACATGG - Intergenic
1006354120 6:33543835-33543857 GGCACTAGTTCCCAGAGACAGGG + Intergenic
1007718983 6:43874309-43874331 GGCACCTCTGCCCAGGGGCATGG - Intergenic
1008560986 6:52724612-52724634 TGGCGCACTGCCCAGAGCCAAGG + Intergenic
1008993257 6:57628301-57628323 GCCAGGACTGCCCAGAGTGAGGG - Intronic
1010833294 6:80556676-80556698 GGCTGCACTGAGCTGAGACATGG + Intergenic
1013304830 6:108838447-108838469 TGCGGCTGTGCCCAGAGACAAGG + Intergenic
1013828757 6:114247700-114247722 TGCAGCAATGCTCAGAGGCATGG - Intronic
1015293889 6:131568760-131568782 GGCAGCACTGCTCTGGGACCAGG - Intergenic
1015682189 6:135820551-135820573 GGCAGCACAAGCCAGACACAGGG - Intergenic
1016477307 6:144441490-144441512 GGCAGCACTGCCCAAGACCATGG - Intronic
1016688908 6:146913001-146913023 AGCAGCACTTCCAGGAGACAGGG - Intergenic
1018730652 6:166647338-166647360 GGCCGCAATGGCCAGAGGCATGG + Intronic
1018742944 6:166744334-166744356 GCCAGCATGGCCCAGAGGCACGG - Intronic
1019156946 6:170045606-170045628 GGCAGCACTTCCCACAGAACTGG + Intergenic
1019163289 6:170083071-170083093 CGCACCACTGCCCAGAGAGATGG + Intergenic
1019326130 7:439102-439124 GGCTGCAGTGCCCAGCGGCACGG + Intergenic
1019527703 7:1488138-1488160 CGCAGCGCTGCCCAGAGGCGCGG + Intronic
1019686025 7:2382728-2382750 GACGACACTGCCCAGAGCCAGGG - Intergenic
1019794908 7:3042473-3042495 GGCAGCCCTGGCCTGAGGCAGGG + Intronic
1019852619 7:3574567-3574589 CCCAGCACTGACCAGAGCCAAGG - Intronic
1020277625 7:6634483-6634505 GGCAGCACTGGGAAGTGACAGGG + Intergenic
1020318161 7:6921373-6921395 AGCTGTACTGCCCAGAGTCATGG + Intergenic
1020542171 7:9471298-9471320 GGCAGAGCTGTCCAGGGACATGG + Intergenic
1021408282 7:20299428-20299450 GGCTGCACTGCCCAGATATGTGG + Intergenic
1023188486 7:37555147-37555169 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1024616169 7:51114292-51114314 GGCAGCACGGTAGAGAGACAGGG - Intronic
1024988335 7:55214529-55214551 GGCGGCACTGCCCAGGCAAATGG + Intronic
1026976611 7:74502605-74502627 GGCAGCCCTGCCTTGAGTCAGGG + Intronic
1027432320 7:78127230-78127252 GGCAGCACTCCCCCGACACCAGG - Exonic
1027435544 7:78160251-78160273 GGGAGCCCTGCCCAGAGAACGGG - Exonic
1027703771 7:81502540-81502562 AGGAGCACTGGCCAGAGGCAAGG - Intergenic
1027927158 7:84480553-84480575 GGTAGCAGTGCCCAGGGTCAGGG + Intronic
1028572530 7:92306554-92306576 GGGAGTAGTGCACAGAGACATGG + Intronic
1029290601 7:99499698-99499720 GAGAGCACTGCCCAGAGAGCGGG - Exonic
1030074117 7:105721742-105721764 GGCTGCTCTGCCCAGGGACATGG + Intronic
1030205886 7:106952422-106952444 GGCTCCACTGGCCAGAGACCAGG - Intergenic
1030292940 7:107890250-107890272 GGCAGCTCTGTCCTGTGACAGGG - Intergenic
1030552076 7:110974262-110974284 GGGAGCTTTGCCAAGAGACATGG + Intronic
1031663303 7:124454274-124454296 GGCAGCAATGCCCAGATATGTGG - Intergenic
1032701358 7:134382466-134382488 AGCACCATTGCCCAGAGAGAAGG + Intergenic
1033067439 7:138169469-138169491 GACAGACCTGCCCAGAGGCAAGG - Intergenic
1033546666 7:142407304-142407326 GACAGAAATGCCCAGAGAGAAGG + Intergenic
1035034519 7:155886277-155886299 GGCAACACTGCCCTGTGTCACGG + Intergenic
1035288923 7:157824792-157824814 GGCAACACTCCTCAGAGAAAGGG + Intronic
1035464968 7:159068996-159069018 TACTGCACAGCCCAGAGACAGGG - Intronic
1035640662 8:1182707-1182729 GTCTGCGCTGCCCTGAGACACGG + Intergenic
1036376726 8:8206924-8206946 TGGATCACCGCCCAGAGACAAGG + Intergenic
1036709515 8:11069125-11069147 GGCGGCTCAGCCCAGAAACATGG + Intronic
1036852812 8:12216214-12216236 TGGATCACCGCCCAGAGACAAGG - Intergenic
1036874182 8:12458736-12458758 TGGATCACTGCCCAGAGACAAGG - Intergenic
1037150062 8:15626209-15626231 GACAGCAGTGACCAGGGACAGGG - Intronic
1037754090 8:21700329-21700351 GGCAGGGCTGCCCAGAGAGGGGG + Intronic
1037765799 8:21771503-21771525 GGCAGCACTGGGCAGAGAGGAGG + Intronic
1039039801 8:33396189-33396211 GGTAGCATTGCCCAGAGTGAGGG - Intronic
1040095605 8:43439582-43439604 GGCAGCTCTGCCAATAGAAAAGG + Intergenic
1040627131 8:49161703-49161725 GGCAACACTGGCCAATGACATGG + Intergenic
1040681531 8:49816765-49816787 GGCAGCTCTGCCCCGAGAAGTGG - Intergenic
1042053041 8:64732253-64732275 GGCAGAGCTGCCCAAAGCCATGG + Intronic
1043162466 8:76863154-76863176 GGGGGCACTGCTGAGAGACAGGG - Exonic
1044931928 8:97259587-97259609 CGCAGCACTGCCCAGGGCCGGGG + Intergenic
1045915108 8:107460058-107460080 GGAAGCATAACCCAGAGACATGG - Intronic
1046186099 8:110721602-110721624 GGGATTAGTGCCCAGAGACAGGG - Intergenic
1046311184 8:112440337-112440359 GGCAGAGCTGCCCAGGGATATGG - Intronic
1047491542 8:125378883-125378905 GGCAGCACAGGCCAGTGATAGGG + Intergenic
1047790362 8:128197418-128197440 GGCAGCACAGTCAAGGGACAGGG + Intergenic
1047972213 8:130094955-130094977 TGCAGCGTTGCTCAGAGACATGG - Intronic
1048111394 8:131472394-131472416 GGCAGAACTGCCCAATGCCATGG + Intergenic
1048865063 8:138754744-138754766 GTCAGAACTGACCAGAAACATGG + Intronic
1049531282 8:143156873-143156895 TGCAGCAGTGGCCAGAGACCAGG + Intergenic
1049655612 8:143795639-143795661 GTCAGCCCTGCCCAGGGACGCGG - Intronic
1050646132 9:7721464-7721486 AGCAGCTCTGTCAAGAGACAAGG - Intergenic
1052666003 9:31496419-31496441 GGCAGAGCTGCCCAAAGCCATGG - Intergenic
1052981999 9:34457094-34457116 GCCAGCACAGCTCAGAGAAATGG + Intronic
1052989093 9:34508276-34508298 GGGAGGACTGCCCAGGCACAGGG + Intronic
1053053327 9:34978823-34978845 GGCAGCCCTTCCCAGGGACTCGG + Exonic
1053447641 9:38165167-38165189 AGAAGCACTGCCCAAAGAAAGGG - Intergenic
1054784078 9:69193809-69193831 GGCAGCAAAGACAAGAGACAGGG - Intronic
1056701955 9:88918359-88918381 GCCAGGACTGCACAGAGAGAGGG + Intergenic
1056723245 9:89089502-89089524 GCCAGCACTGCCCTTAGGCAAGG + Intronic
1056950315 9:91036291-91036313 GGCAGCCCTGCTCTGAAACAGGG - Intergenic
1057444615 9:95104823-95104845 GTCAGCCCTGCCCTGTGACAAGG - Intronic
1058039471 9:100288198-100288220 GGTAGCAGAGCCAAGAGACATGG - Intronic
1060147387 9:121264748-121264770 GGGTGCACTTCCCAGAGAAAAGG - Intronic
1060423524 9:123486392-123486414 GGCGGCAGAGCCCAGAGCCAAGG - Intronic
1060553544 9:124496904-124496926 GGCAGCAGTGCCCAGGGCCCAGG - Intronic
1060627421 9:125126331-125126353 GGCAGCACTGCATAGAGGGAAGG - Intronic
1060833956 9:126740878-126740900 GGTAGCACTTAACAGAGACAAGG - Intergenic
1060924346 9:127445544-127445566 GCCAGCATTGCCCAAAGACTTGG - Intergenic
1061300791 9:129703879-129703901 TGCAGCACTGCCCAGAGCCAGGG + Intronic
1061307964 9:129743256-129743278 GGCCGCAGTGGCCAGGGACAGGG + Intronic
1062138745 9:134943982-134944004 GCCAGCCCTGCCCACACACAGGG - Intergenic
1062209521 9:135356155-135356177 GGCAGCACTGACGGGAGCCACGG + Intergenic
1062312146 9:135944642-135944664 GGGGGCCCTGCCCAGAGACCGGG - Intronic
1062443416 9:136583568-136583590 GGCGGCACTGGCCACAGGCAGGG - Intergenic
1203770760 EBV:48906-48928 GGCAGCACTGCCCGGATTCGGGG - Intergenic
1185520453 X:734673-734695 GCCAGCACCGGCCAGAGATACGG + Intergenic
1188872220 X:35387113-35387135 AGGAGCACTGCCCAGAGAGAGGG + Intergenic
1189185712 X:39053011-39053033 GGCAGCCCTTCCCAGTGAGAAGG + Intergenic
1191606278 X:63066088-63066110 AGATGCCCTGCCCAGAGACAAGG - Intergenic
1192077859 X:68018380-68018402 AGCAGCACTACCCAGATACTAGG + Intergenic
1193552593 X:82915233-82915255 GGCAGGGGTGCCCAGAGAGATGG - Intergenic
1194219876 X:91176964-91176986 GGCAGAACTGCCCAAGGCCATGG + Intergenic
1196441528 X:115723553-115723575 GGCTGCCCTGCCCACAGGCAGGG + Intergenic
1196445058 X:115841542-115841564 GGCTGCCCTGCCCACAGGCAGGG + Intergenic
1199170696 X:144731758-144731780 GGCAGAGCTGCCCACAGACTTGG - Intergenic
1199192110 X:144982199-144982221 GGCAGAGCTGCCCAAAGCCATGG + Intergenic
1199860129 X:151793957-151793979 GGCAGCCTTGCCAAGAGTCAGGG - Intergenic
1200556383 Y:4640728-4640750 GGCAGAACTGCCCAAGGCCATGG + Intergenic
1201985091 Y:19957271-19957293 GGCAGCATTGCACAGGGGCAGGG - Intergenic