ID: 1076701427

View in Genome Browser
Species Human (GRCh38)
Location 10:132275232-132275254
Sequence AGTAGCCATGGGGCCTGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 369}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701427_1076701447 19 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701427_1076701445 13 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701427_1076701450 29 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701427_1076701437 6 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701427_1076701438 7 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701427_1076701451 30 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701427_1076701449 28 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701427_1076701441 9 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701427_1076701448 20 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701427_1076701434 -5 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701427_1076701444 12 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701427_1076701439 8 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701427_1076701436 3 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701427_1076701435 -4 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701427 Original CRISPR AGTAGCCATGGGGCCTGGTG GGG (reversed) Intronic
900038696 1:438480-438502 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
900060130 1:673459-673481 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
900302971 1:1987102-1987124 CGTGGCAATGGGGCCAGGTGAGG + Intronic
900310860 1:2032571-2032593 AGGAGCCTGGGGGCCTGGGGTGG - Intergenic
900314004 1:2048172-2048194 CCTGGCCATGGGGCCTGGAGTGG + Intergenic
902271761 1:15309956-15309978 AGGGGCTATGGGACCTGGTGGGG + Intronic
903338577 1:22640779-22640801 AGAAGCCAGGGAGGCTGGTGAGG - Intergenic
903629365 1:24755254-24755276 AGTAGAGATGGGGCCAGGAGTGG - Intronic
904110498 1:28122351-28122373 AATAACCATGGGGCTTGGTAAGG + Intergenic
904773779 1:32894772-32894794 AGTGGCCATCGGGCCTGGGCAGG + Exonic
906354499 1:45092591-45092613 ACTAACCATCGGGCCAGGTGCGG - Intronic
906680269 1:47721504-47721526 AGGATCCATGGGCCTTGGTGAGG - Intergenic
908222095 1:62017431-62017453 AGTAGACTTAGGGCCAGGTGTGG + Intronic
909527238 1:76639379-76639401 AGTAGAGCTGGGGGCTGGTGCGG - Intergenic
910253990 1:85228795-85228817 TGTAACAATGGGGCCAGGTGTGG - Intergenic
910477580 1:87623389-87623411 AGTAGACTTGGGGCCGGGCGCGG + Intergenic
911422543 1:97662290-97662312 AGTTGACTTGGGGCCAGGTGCGG - Intronic
911726959 1:101252102-101252124 AGGAGCCCTGGGGTCAGGTGTGG - Intergenic
911902338 1:103522399-103522421 AGTAGCCATGTGGTCAAGTGAGG + Intergenic
916349629 1:163834380-163834402 AGTAGACATGTGCCATGGTGTGG + Intergenic
916723605 1:167503760-167503782 AGGAACCATGGGGCCAGGTGAGG + Intronic
918420951 1:184363828-184363850 TGCAGCCACGGGGGCTGGTGAGG - Intergenic
920288338 1:204898026-204898048 ATTAGCCAGGCGGCTTGGTGCGG - Intronic
920762847 1:208802348-208802370 AGGAGGCATGGGGCTGGGTGTGG - Intergenic
921207720 1:212862868-212862890 AGTAGCCATGCTACCTGGTGTGG + Intronic
921870335 1:220132814-220132836 AGGAGACATGGGGCTGGGTGCGG - Intronic
922424582 1:225481076-225481098 AGTTCCCATGGGGCCCTGTGTGG + Intergenic
922456254 1:225776005-225776027 AGTAGCAATAGTCCCTGGTGAGG - Intergenic
923504170 1:234591325-234591347 AGTAGCCCTGGGGCTTGGCAGGG + Intergenic
923567887 1:235090422-235090444 AGCAGCCACTGGACCTGGTGCGG + Intergenic
923647577 1:235839622-235839644 AGTAGAGATGGGGCGTGGTGGGG - Intronic
923674590 1:236068913-236068935 AGTTACCTTGGGGCCGGGTGTGG - Intergenic
1063610701 10:7559739-7559761 AGCAGACATGGTGTCTGGTGAGG + Exonic
1067750769 10:48969709-48969731 AGTAGGAATGGGGCCTGAGGAGG - Intronic
1068663436 10:59647444-59647466 AGTATCAATGAGGGCTGGTGAGG + Intergenic
1069454491 10:68543005-68543027 AGGAGCCACTGGGCCTGGCGTGG + Intergenic
1069767552 10:70874432-70874454 ATTAGCCATGAGGCCGGGCGCGG + Intronic
1069816793 10:71201677-71201699 GGTATCCATGGGGGCTGGGGAGG - Intergenic
1070159423 10:73857007-73857029 TGTTGCCATGGGGGCTTGTGGGG + Intronic
1070796758 10:79221445-79221467 AGGAGGGAGGGGGCCTGGTGAGG - Intronic
1070906793 10:80079878-80079900 AGTAGACATGGGTATTGGTGAGG + Intronic
1072255203 10:93614366-93614388 GGTTACCATGGGGCCTGGTAGGG + Intronic
1073115578 10:101089809-101089831 AGAGGCCATGGGGCCTGGGGAGG - Exonic
1073381642 10:103082308-103082330 ACTATCCAATGGGCCTGGTGGGG + Exonic
1074572168 10:114633996-114634018 AGGAGGAATGGGGGCTGGTGTGG - Intronic
1074634342 10:115296128-115296150 GGTAGCAATGGGGGCTGGTGGGG + Intronic
1074882212 10:117667971-117667993 AGTGGCCAAGTGGCCGGGTGGGG - Intergenic
1075531855 10:123236520-123236542 GGTGGCAATGGGGGCTGGTGGGG + Intergenic
1075606911 10:123818263-123818285 AGTAGCCATGGGGGCAGGGATGG + Intronic
1076551572 10:131281655-131281677 AGTAGCCAGGGGGACTGTGGAGG - Intronic
1076701427 10:132275232-132275254 AGTAGCCATGGGGCCTGGTGGGG - Intronic
1076964905 11:74392-74414 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
1077180137 11:1208571-1208593 AGGGGCCCTGGGGCCAGGTGGGG + Intergenic
1079007437 11:16801880-16801902 AGTAGCTTTGGTTCCTGGTGTGG - Intronic
1079032325 11:16994814-16994836 GGGAAGCATGGGGCCTGGTGGGG - Intronic
1079345824 11:19651479-19651501 TGCAGCCATGTGGCCCGGTGGGG - Intronic
1080666884 11:34344047-34344069 AGAAGGCATGGGGCCTGGAGTGG - Intronic
1080816882 11:35766812-35766834 AGTATCCAGGGAGGCTGGTGAGG - Intronic
1081297487 11:41409869-41409891 AGTAGCCATATGACTTGGTGTGG - Intronic
1081858858 11:46320612-46320634 AGTAGGGATGGGGCCTTGGGAGG - Intronic
1083059218 11:59851987-59852009 AGTAGCCATTGTGACTGGTGTGG + Intergenic
1083318788 11:61832622-61832644 AGAAGCAATGGAGGCTGGTGGGG - Intronic
1083465529 11:62843111-62843133 AGTAGGCAGGGGGCCGGGCGTGG + Intergenic
1083688321 11:64391050-64391072 AGTGGACTTGGGGCCGGGTGTGG + Intergenic
1084032402 11:66488621-66488643 AGTAGTAGTGGGGCCTGGGGTGG + Intronic
1084795433 11:71501871-71501893 TCTAGGCATGGGGCCAGGTGTGG + Intronic
1085338002 11:75712051-75712073 GGTAGCCAAGGGGCCTGGGGAGG - Intergenic
1085405982 11:76262435-76262457 CGTAGCCAAGGGGTCTGGGGAGG - Intergenic
1088063512 11:105686757-105686779 AATAGCCATTGTGACTGGTGTGG + Intronic
1088728531 11:112660195-112660217 AGTAGCCAGGGGCCCTTCTGTGG - Intergenic
1089290220 11:117433197-117433219 TGTAGCCGTGGGCCCTGGGGTGG + Exonic
1089955164 11:122563872-122563894 AGTGTCAATGGGGTCTGGTGGGG - Intergenic
1090402312 11:126456655-126456677 CGTGGACTTGGGGCCTGGTGTGG + Intronic
1091584200 12:1806656-1806678 AGCAGCCAGGAGGCCTGGGGAGG + Intronic
1092347580 12:7728634-7728656 ATTAGCCAGGTGGCCGGGTGCGG - Intergenic
1092447614 12:8571994-8572016 AGTGGACATGAGGCCAGGTGAGG - Intergenic
1093397688 12:18703739-18703761 AGTAGTCATTGCTCCTGGTGTGG - Intronic
1094366401 12:29687732-29687754 AGTAGGGTTGGTGCCTGGTGAGG + Intronic
1096381541 12:51162475-51162497 AAGAGCCATGGGGCCTACTGGGG + Intronic
1097093640 12:56527756-56527778 AGTATCAAGGGGGCATGGTGGGG - Intronic
1097116034 12:56697942-56697964 ATTAGCCATGTGGCCTGGTGTGG + Intergenic
1097281910 12:57850213-57850235 AGTTCCCAAGAGGCCTGGTGAGG + Intergenic
1097515078 12:60594523-60594545 AGTAGCCATGGGAACTAGAGTGG - Intergenic
1098423344 12:70328756-70328778 AGTACCCCTGGAGCCAGGTGTGG - Intronic
1098808945 12:75059292-75059314 AGTAGCCATGAGGCCTTTTCTGG + Intronic
1100259142 12:92915318-92915340 AGTAGCCAGGTGTGCTGGTGTGG + Intronic
1101098876 12:101371812-101371834 GTGAGCCATGGTGCCTGGTGGGG + Intronic
1101343041 12:103860002-103860024 TGAAGCCCTGGGCCCTGGTGGGG + Intergenic
1101509212 12:105377529-105377551 AGTAGGTATGGGGCGTGGTCAGG + Intronic
1102213917 12:111146841-111146863 AATAGCTCTGGGGCCAGGTGCGG + Intronic
1103649227 12:122420643-122420665 ACCAGCCTTGGGGCCAGGTGCGG + Intronic
1104347643 12:128016348-128016370 AGTAGCAAAAGGGCCGGGTGCGG + Intergenic
1104887640 12:132120004-132120026 TATGGCCATAGGGCCTGGTGGGG - Intronic
1105618759 13:22046720-22046742 AGTAGGCCTGGGGCTTGGAGAGG - Intergenic
1106843937 13:33717402-33717424 AGTAGTGTTGGGGCCAGGTGCGG + Intergenic
1107896105 13:44965416-44965438 ACCAGGCATGGGGCCAGGTGCGG + Intronic
1108038028 13:46312399-46312421 AGGAGCCATGGCGCCTGGCCTGG - Intergenic
1108525857 13:51285418-51285440 TGGAGCCATGTGGCCTGGGGCGG - Intergenic
1112094824 13:96120972-96120994 AATAGCCATAGGGCCTGGCCTGG + Intronic
1113593829 13:111518048-111518070 GGGAGCCAGGGGGGCTGGTGAGG - Intergenic
1113810076 13:113135416-113135438 AGCAGATATGGGGCCTGATGAGG + Intronic
1114877218 14:26735384-26735406 AGTAGCCATTCTGACTGGTGTGG - Intergenic
1118573624 14:67219241-67219263 GGTAGCAATGGGGGCTGGTGGGG + Intronic
1118709914 14:68510508-68510530 AGAAGCCCTGGGTCCTGTTGGGG + Intronic
1119033870 14:71213698-71213720 AGTAGCCATGGGAGCTACTGGGG - Intergenic
1119091101 14:71782038-71782060 ATAAGCAACGGGGCCTGGTGCGG + Intergenic
1119451884 14:74718867-74718889 ATTAGCCAGGGGGCCAGGTGCGG + Intronic
1119541415 14:75440688-75440710 GATAGCGCTGGGGCCTGGTGTGG + Intronic
1119546038 14:75472079-75472101 AGCAGCCAGTGGTCCTGGTGAGG - Intronic
1121182447 14:91939630-91939652 AGCATCGATGGGGCCGGGTGCGG - Intronic
1121861041 14:97318456-97318478 AGTAGCCATGGACACGGGTGTGG + Intergenic
1122102502 14:99424628-99424650 GGAAGCCCTGGGGCCTGGTCAGG - Intronic
1122151466 14:99728314-99728336 AGTACAGGTGGGGCCTGGTGTGG + Intergenic
1122721812 14:103726538-103726560 CGTAACCATGGGGCCTGAGGTGG - Intronic
1122763835 14:104050748-104050770 GATGGCCATGGGGGCTGGTGTGG - Intronic
1124625592 15:31306052-31306074 AATAGCCATCTGGGCTGGTGGGG + Intergenic
1124865897 15:33490919-33490941 AGTATCCATGGGGCTTGGCACGG + Intronic
1125657212 15:41367723-41367745 AGTAGCAATGGGGGCTGGTGGGG + Intronic
1126020501 15:44396062-44396084 TTTAGCCATGAGGCCAGGTGTGG + Intronic
1126612316 15:50542104-50542126 ACTAGCCTTGTGGCCTGGTTTGG + Intronic
1127412299 15:58721735-58721757 ATTAGCCAGGTGGCCGGGTGTGG + Intronic
1130307509 15:82723760-82723782 AGTAGTGATGGGGCCAGGTGAGG - Intergenic
1130446654 15:84008383-84008405 ACTCACCACGGGGCCTGGTGTGG - Intronic
1131148993 15:90035198-90035220 AATGGCCCTGGGGCATGGTGTGG + Intronic
1131259382 15:90880682-90880704 AGTAGTCATGTGGCCTGGGGAGG - Exonic
1131857263 15:96610267-96610289 AGCAGCTATAGGGCCAGGTGTGG - Intergenic
1132443220 15:101889134-101889156 ATTAGCACTGGGGCCTGTTGTGG - Intergenic
1132749960 16:1452942-1452964 AGTTGCCATGGGGCCTGCGGAGG - Intronic
1132885434 16:2180196-2180218 AGAGGCCATCGGGCCTGGCGGGG - Exonic
1133176859 16:4021914-4021936 AGGAGCCATGGGGTCTGATAGGG - Intronic
1134405684 16:13956608-13956630 GGAAGCCATGGGGGGTGGTGAGG + Intergenic
1134619710 16:15678265-15678287 AGTAGCCATGATGCCAGGAGGGG + Intronic
1134692294 16:16198701-16198723 ATTAGCCAGGGGGCCGGGTGCGG + Intronic
1134979555 16:18595977-18595999 ATTAGCCAGGGGGCCGGGTGCGG - Intergenic
1135037389 16:19089598-19089620 AGTAGCCATGTGGCCAGGCCTGG - Intergenic
1135640291 16:24113924-24113946 AGTAGACAGAGGGCCGGGTGCGG + Intronic
1136180159 16:28546249-28546271 AGTAAACATGGGGCCGGGCGTGG + Intergenic
1136401803 16:30023348-30023370 TGTGGCCATGGGTGCTGGTGTGG + Exonic
1136776533 16:32874711-32874733 AGAAGCCATCAGGGCTGGTGAGG - Intergenic
1136894082 16:33986801-33986823 AGAAGCCATCAGGGCTGGTGAGG + Intergenic
1137860483 16:51841729-51841751 AGGAGCCAAGGTGGCTGGTGGGG + Intergenic
1137915421 16:52424672-52424694 AGTGGCCATGGGGCCTCCGGGGG - Intergenic
1139531487 16:67544726-67544748 AGGAGGCATGGGCCCTGGAGCGG + Exonic
1139540801 16:67614547-67614569 ATTAGCCAGGTGGCCGGGTGTGG + Intronic
1139669621 16:68483844-68483866 AGTACCCTTGGGGCCGGGTGTGG - Intergenic
1140427511 16:74873325-74873347 ATGAGCCATGGGGCCTGGCCAGG + Exonic
1140920794 16:79535859-79535881 AGTAGCAATGCAGCCGGGTGTGG - Intergenic
1141636051 16:85314450-85314472 AGGAACAGTGGGGCCTGGTGAGG + Intergenic
1203078948 16_KI270728v1_random:1136820-1136842 AGAAGCCATCAGGGCTGGTGAGG - Intergenic
1142900970 17:3011355-3011377 TGGAGCCCTGGGGCCTGGGGTGG + Intronic
1143130218 17:4672936-4672958 TGAAGGCATGGGGCCTGCTGAGG + Exonic
1144027997 17:11295671-11295693 GGAAGTCATGGGGCCGGGTGCGG + Intronic
1144630705 17:16870766-16870788 AGCAGCCCCGGGGCATGGTGGGG + Intergenic
1144888958 17:18483142-18483164 AGGAGCTATGGGCCATGGTGAGG - Intronic
1145143250 17:20461154-20461176 AGGAGCTATGGGCCATGGTGAGG + Intronic
1146374945 17:32287671-32287693 AGGAGCCCTGTGGGCTGGTGAGG - Intronic
1146698647 17:34933070-34933092 AGTAGTCATAAGGCCGGGTGTGG - Intronic
1147113882 17:38284319-38284341 AGTAGTCTTGGGGCTGGGTGCGG + Intergenic
1147249375 17:39143972-39143994 AGCAGCCCTGGGGCCTGGGCAGG + Intronic
1147582785 17:41636493-41636515 AGTAGCAAAGGGGCCTGGGGGGG - Intergenic
1147691569 17:42318656-42318678 AGAAGGCATGGGGCAGGGTGAGG + Intronic
1147982349 17:44282384-44282406 AGTGGGCATGGGGGCTGCTGTGG + Intergenic
1148415723 17:47504872-47504894 AGTAGTCTTGGGGCTGGGTGCGG - Intergenic
1148536345 17:48442191-48442213 TGTGGCCATGGGGTGTGGTGGGG + Intergenic
1149329875 17:55569855-55569877 AGTAGCCAGGTAGCCGGGTGTGG + Intergenic
1149404165 17:56329937-56329959 AGTAGATTTGGTGCCTGGTGAGG - Intronic
1150463606 17:65372947-65372969 AGTAGCCAGGGGGCCTGCTTAGG + Intergenic
1151170745 17:72243852-72243874 AGTAGTGATGGGGCGAGGTGAGG + Intergenic
1151269650 17:72984293-72984315 AGTAGCCATGAGACCTGAAGGGG + Intronic
1151575521 17:74951003-74951025 CGTATCCTTGGGGCATGGTGTGG - Exonic
1151813612 17:76459896-76459918 AGACGGCCTGGGGCCTGGTGAGG - Intronic
1152153506 17:78617683-78617705 AGGACCCATGAGGCCTGATGGGG + Intergenic
1152462770 17:80450097-80450119 AGTGGCCACGGGGCCTGTTTTGG + Intergenic
1152786544 17:82250984-82251006 AGTGGGGTTGGGGCCTGGTGAGG - Intronic
1152928703 17:83099470-83099492 GGGAGGCATGGGGCCTGGTGGGG - Intergenic
1153240951 18:3030919-3030941 AATAGCCTTTGGGCCAGGTGTGG + Intergenic
1153490296 18:5640400-5640422 AGCCGCACTGGGGCCTGGTGAGG - Intergenic
1154025973 18:10707226-10707248 ACTGGCCATGAGACCTGGTGCGG - Intronic
1155234204 18:23803374-23803396 AGTAGCCATGGGGGCAGGGATGG - Intronic
1157416692 18:47509366-47509388 AGGAGCCATGTGGTCTGATGGGG + Intergenic
1157448220 18:47764271-47764293 AATAGCCATTTGGCCTGGTGTGG - Intergenic
1157498549 18:48173253-48173275 AGTTGGCGTGGGGCCTGATGTGG - Intronic
1159507184 18:69353099-69353121 AGTAGGCTTGGTGTCTGGTGAGG - Intergenic
1160200802 18:76793764-76793786 AGTAAGCATGGGGCCGGGCGCGG + Intergenic
1160438179 18:78867179-78867201 ACTGGGCGTGGGGCCTGGTGCGG + Intergenic
1160641710 19:144022-144044 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
1162654826 19:12120765-12120787 AGTGGCCAGGTGGCCAGGTGCGG - Intronic
1162826409 19:13255063-13255085 AGTAGTGCTGGGGGCTGGTGTGG + Intronic
1162842613 19:13367435-13367457 AGAAGGCAGGGGGCCAGGTGTGG + Intronic
1163154837 19:15433962-15433984 AGTACCGAAGGGGCCGGGTGCGG + Intronic
1163702935 19:18795630-18795652 TGGAACCACGGGGCCTGGTGTGG - Intergenic
1165079084 19:33297582-33297604 ATGAGCCACTGGGCCTGGTGAGG - Intergenic
1166125472 19:40713212-40713234 ATTAGCCAGGCGGCCAGGTGTGG + Intronic
1166161931 19:40960610-40960632 AGTAGCCATGGAGCTGGGGGAGG - Intergenic
1166412410 19:42564818-42564840 CGTACACATGGAGCCTGGTGCGG + Intergenic
1166564680 19:43756509-43756531 AGTAGGGATGAGGCCTGGAGGGG - Intergenic
1167111733 19:47466395-47466417 GGGAGCCATGGGGGGTGGTGGGG + Exonic
1167248949 19:48390804-48390826 GGTAGCCATGAGGCCTAGTCTGG - Intronic
1167299441 19:48670591-48670613 AGTGGCCTTAGGACCTGGTGTGG + Exonic
1168341297 19:55624478-55624500 AGGAGCCACTGGACCTGGTGCGG - Exonic
1168355084 19:55695530-55695552 ACTGGACATGGGGCCTGGGGAGG + Intronic
924996792 2:368737-368759 AGTAGGACTGGGGTCTGGTGAGG + Intergenic
925178363 2:1800463-1800485 AGCAGCCACATGGCCTGGTGGGG + Intronic
926214666 2:10897264-10897286 AGTAGCTATGGGGTCTGGATAGG - Intergenic
926311585 2:11679671-11679693 ATCAGCCAAGGGGCCTGCTGAGG - Intronic
930097428 2:47576062-47576084 AGTAGCCTTGGTGCCTGAAGTGG + Intergenic
930105253 2:47634165-47634187 AGTAGCTATGTGGCCTTGTGAGG + Intergenic
930272176 2:49269916-49269938 AGCAGCCATGGTGTCTGGTGAGG + Intergenic
930711216 2:54552743-54552765 AGCAGACCTGGGGCCAGGTGTGG - Intronic
930809304 2:55524401-55524423 ATTAGCCATGTGTGCTGGTGCGG - Intronic
931147311 2:59533468-59533490 AGGAGGCATGGGGCCGGGCGTGG - Intergenic
931236226 2:60414503-60414525 AACAGCCATGGGGCCTGGATAGG - Intergenic
931811637 2:65859822-65859844 AGATGCCATGGGGCTTGGGGAGG + Intergenic
932283398 2:70513612-70513634 AGTAGCAAGGGGGACTGGTGGGG + Intronic
932452946 2:71827430-71827452 AGAGGCCTGGGGGCCTGGTGGGG - Intergenic
934168049 2:89314197-89314219 AGAAGCCATTGTGCCTGGTGAGG - Intergenic
934168176 2:89315607-89315629 AGAAGCCACTGTGCCTGGTGAGG - Intergenic
934199110 2:89866974-89866996 AGAAGCCACTGTGCCTGGTGAGG + Intergenic
934199236 2:89868384-89868406 AGAAGCCATTGTGCCTGGTGAGG + Intergenic
935710968 2:105897782-105897804 AGTAGCCATTCTGACTGGTGTGG + Intergenic
936110494 2:109660631-109660653 AGTAGCCAGTTGGCCTGGTGTGG + Intergenic
937145686 2:119642433-119642455 AGTAGACTTGGTGTCTGGTGAGG + Intronic
937724413 2:125144622-125144644 AGTGGACATGGGGCCAGGCGCGG - Intergenic
939336531 2:140835827-140835849 AATAGGCATGTGGCCAGGTGCGG - Intronic
939521292 2:143233933-143233955 GATAGCCATTGGGCCTGGTGCGG - Intronic
942285839 2:174415071-174415093 AATAGTCATGGGGCTGGGTGCGG - Intronic
942349398 2:175037462-175037484 TGTTGACATGGGGCCGGGTGTGG + Intergenic
942659837 2:178252896-178252918 TGTAGTCATGGCTCCTGGTGTGG + Intronic
944268850 2:197759318-197759340 AGTAGCAATGCAGGCTGGTGGGG - Intronic
944624601 2:201558578-201558600 GGTGGCAATGGGGGCTGGTGGGG - Intronic
944687639 2:202131883-202131905 AGCAGCTAAGAGGCCTGGTGCGG + Intronic
944798754 2:203215065-203215087 AGCAACCATTAGGCCTGGTGCGG + Intronic
945369957 2:209004324-209004346 AGAAGTCAAGGGGCATGGTGCGG + Intergenic
946183863 2:217965795-217965817 AGCAGCCAGGGTGGCTGGTGTGG + Intronic
947555228 2:231086364-231086386 AGTAGCCCTGGGGCCGGGCATGG + Intronic
948382234 2:237558869-237558891 AGCAGCCACGGGGGCTGGGGTGG + Intergenic
948423784 2:237875796-237875818 ACCAGCCATTGGGCCTGGAGTGG + Intronic
948424430 2:237878264-237878286 GGGAGCCCTGGGGACTGGTGGGG + Intronic
1168820390 20:768979-769001 AGGGGTCATGGGCCCTGGTGAGG - Intergenic
1171878150 20:30597573-30597595 AGCAGCCTGGGGGCCAGGTGAGG - Intergenic
1172119664 20:32590603-32590625 AGTTGCCATGAGGCTGGGTGTGG + Intronic
1172655948 20:36538399-36538421 AGTGTACAAGGGGCCTGGTGTGG - Intergenic
1172837189 20:37880771-37880793 GGTAGCCATGGGGCCGAGGGAGG - Intergenic
1172941243 20:38656128-38656150 AGGAGCCATGGGTGCTGGGGTGG + Intergenic
1174401393 20:50277927-50277949 AGTGCCCATGGGACCTGCTGGGG - Intergenic
1175358098 20:58384995-58385017 AGTGGCCATGGTGGCAGGTGTGG + Intergenic
1175915092 20:62422533-62422555 AGAGGCCATGGGGCCTGGGGTGG + Intronic
1176246163 20:64098181-64098203 GGGAGCCAGGGAGCCTGGTGAGG - Intronic
1178179463 21:30143616-30143638 AGTAGCCATGGGGCACTGGGAGG + Intergenic
1178626074 21:34220021-34220043 AGAAGCCATGGGGCTTCATGGGG - Intergenic
1178950200 21:36979764-36979786 ATTAGCCAGGCGGCCAGGTGTGG + Intronic
1179183480 21:39064474-39064496 AGGAGCCCTGAGGCCAGGTGAGG + Intergenic
1179380672 21:40896208-40896230 ACTGGACATGGGGCCTGGTTGGG + Intergenic
1179823830 21:43952776-43952798 AGGTGCCATGGGGACTGGAGAGG + Intronic
1180175302 21:46084298-46084320 AGCAGCCACAGGGCCGGGTGTGG - Intergenic
1180665349 22:17506415-17506437 AGTAGAGAGGGGGCCAGGTGTGG - Intronic
1182043540 22:27257092-27257114 AACAGCCATGGCTCCTGGTGTGG - Intergenic
1182273031 22:29167686-29167708 AGTAGGCCTGGGGCCTTTTGAGG - Exonic
1182283343 22:29230641-29230663 GCCAGCCAAGGGGCCTGGTGTGG - Intronic
1182369780 22:29802650-29802672 AGTAGCCAGGTGGCCGGGTGTGG + Intronic
1182671579 22:32000615-32000637 AGTAGCCAAGGGGCAGGGTGGGG + Intergenic
1183196672 22:36358353-36358375 AATAGCGTTTGGGCCTGGTGCGG - Intronic
1184535123 22:45081545-45081567 AGTAGAGATGGGGCCGGGCGCGG - Intergenic
1184587336 22:45456921-45456943 AATAACCCTGGGGCCCGGTGTGG - Intergenic
1185083847 22:48725238-48725260 ATGAGCCATGGGGCATGGCGGGG - Intronic
1185289490 22:50016416-50016438 ACTGCCCATGGGCCCTGGTGAGG - Exonic
949212869 3:1526357-1526379 AGTAGACATGCGGCCGGGCGCGG - Intergenic
949793671 3:7822810-7822832 AGTGACAATGGGGGCTGGTGAGG - Intergenic
950500012 3:13357822-13357844 AGTAGGCGTGGGGGCTGCTGAGG - Intronic
950934577 3:16825553-16825575 AGTAGCCATGGAGCCGGGGATGG + Intronic
952627985 3:35429728-35429750 AGTAACCATGTGCCCTGGTTAGG + Intergenic
953980476 3:47410751-47410773 AGGAGTCCTGGGGCCTGGGGTGG - Exonic
954115528 3:48465104-48465126 AGAAGCCATGGGGGCTGGGCAGG - Intronic
954261705 3:49443805-49443827 AGAAGCAATGGGGCCTGGGCAGG - Intergenic
954280031 3:49570716-49570738 ATTAGCCAGAGAGCCTGGTGGGG + Intronic
954709543 3:52498547-52498569 GGGAGCTTTGGGGCCTGGTGTGG - Intronic
955437841 3:58922416-58922438 GTTAGAGATGGGGCCTGGTGGGG + Intronic
955681373 3:61505398-61505420 GGTAGCCAGAGGGCCTGGTTGGG + Intergenic
957632646 3:82737495-82737517 ATTTCCCATGGGGCTTGGTGGGG - Intergenic
957899753 3:86473953-86473975 AGTATTCATGGGGCCTGGCTGGG + Intergenic
959323135 3:104904333-104904355 TGAAGCCATGGGGGCTGGTCTGG + Intergenic
960019312 3:112931981-112932003 AGTAGCTATAGGGGCTGGTGGGG - Intronic
961366566 3:126403244-126403266 TGAAGCCATGGGCACTGGTGAGG + Intronic
961433048 3:126896832-126896854 AGGAGACATGGGGGCTGGAGAGG + Intronic
961433307 3:126898410-126898432 AGGAGACATGGGGACTGGAGAGG + Intronic
963075397 3:141342034-141342056 AGTAACAATGGGGCCGGGTACGG + Intronic
964269379 3:154939323-154939345 GGTGGCAATGGGGGCTGGTGGGG - Intergenic
964374169 3:156033303-156033325 TGTAGGCATGGAGCCTGGTCTGG + Intergenic
967878054 3:194280122-194280144 AGGTGCCATTGGGCATGGTGGGG + Intergenic
967989439 3:195120291-195120313 TGTGGCCATGGGGGCTGGGGCGG - Intronic
968037218 3:195557928-195557950 ACTAGACATAGGGCCGGGTGCGG + Intergenic
968504623 4:966125-966147 AGGAGACAGAGGGCCTGGTGCGG - Intronic
969422655 4:7106362-7106384 AGCAGCCATGGGGCGGGGTGAGG + Intergenic
969441570 4:7220203-7220225 GGGTGCCATGGGGCCTAGTGAGG + Intronic
970986724 4:22167433-22167455 AGTAGCCATTCTGACTGGTGTGG + Intergenic
971048334 4:22831241-22831263 AGTGGCAATGGGGGCTGCTGGGG - Intergenic
972439118 4:39067971-39067993 AGGAGTTATGGGGCCAGGTGTGG - Intronic
974675658 4:65085324-65085346 AATAGCCATTCGGACTGGTGTGG + Intergenic
975629295 4:76383367-76383389 TATAGCCAGGGGGCATGGTGAGG - Intronic
976344507 4:83985058-83985080 CGTATCTCTGGGGCCTGGTGAGG + Intergenic
977004702 4:91550307-91550329 ACCAGTCATGGGGCATGGTGTGG - Intronic
978533753 4:109739521-109739543 AATAGCCTTGGGGTCGGGTGGGG + Intergenic
980148193 4:129015239-129015261 AGTTGCCATGGGTCCAGGGGTGG + Intronic
980876861 4:138670406-138670428 AGTGGTCCTGGGGCCTGGTTTGG - Intergenic
981360494 4:143840168-143840190 GGTCGCAATGGGGGCTGGTGCGG + Intergenic
981477410 4:145200736-145200758 AGTATCCATGGGGTGGGGTGGGG + Intergenic
981800248 4:148647547-148647569 AGTAGTTGTGGGGCCAGGTGCGG + Intergenic
983637824 4:169916164-169916186 AATAGCAATGAGGCCAGGTGCGG - Intergenic
985632607 5:1021898-1021920 AGAGGGCCTGGGGCCTGGTGGGG - Intronic
987635300 5:20531718-20531740 AGCAACAATGGGGCCTGTTGGGG + Intronic
988235943 5:28544704-28544726 AGTAGCCATTATGACTGGTGTGG + Intergenic
990873450 5:60458751-60458773 AGTATCCATGAGTCCGGGTGTGG - Intronic
991522548 5:67516717-67516739 ACTATCCATGGGGCCAGGAGTGG + Intergenic
992224443 5:74606393-74606415 AGCAGTCATGGGGCCGGGTGTGG + Intergenic
992727754 5:79626595-79626617 ATTAGCCAGGTGGCCGGGTGCGG - Intronic
993247311 5:85467363-85467385 AATAACGATGGGGGCTGGTGGGG + Intergenic
993293443 5:86104663-86104685 AGAAGCAAGCGGGCCTGGTGCGG + Intergenic
995492454 5:112707539-112707561 AGTAGCAAGGGGGCGGGGTGTGG + Intronic
998502189 5:142643089-142643111 AGAAGCCATGGAGCCTCCTGGGG - Intronic
999158021 5:149472382-149472404 ATTAGCCAGGCGGCGTGGTGGGG - Intergenic
1000541151 5:162541937-162541959 ACTAGGGAAGGGGCCTGGTGTGG + Intergenic
1002202357 5:177536966-177536988 AAAAGGCATGGGGCCTTGTGTGG - Intronic
1002735151 5:181380463-181380485 ATTAGCACTGGGGCCTGTTGTGG - Intergenic
1002749375 6:93660-93682 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
1005053662 6:21709741-21709763 ATTAGGCATGAGGCCGGGTGTGG + Intergenic
1006577193 6:35055139-35055161 AGAGACCACGGGGCCTGGTGGGG + Intronic
1007075673 6:39064708-39064730 GGTGGACATGGGGCATGGTGGGG + Intronic
1007321668 6:41032466-41032488 AACAGACTTGGGGCCTGGTGTGG + Intronic
1007661954 6:43492285-43492307 AGTAGGCAGGGGGCCAGGTCAGG + Intronic
1007744031 6:44031221-44031243 AGAAGCCCTGGGGGCTGGAGAGG - Intergenic
1008517226 6:52329487-52329509 AGGAGGAGTGGGGCCTGGTGCGG - Intergenic
1008947187 6:57111209-57111231 AGTGGGAATGGGGCCTGGTACGG - Intronic
1010143501 6:72639048-72639070 AGTAGACATGTGGCCTGTTTGGG + Intronic
1010346240 6:74814533-74814555 AGTAGCCATGTGGGCTGCAGGGG - Intergenic
1010397591 6:75409801-75409823 AGGAGTCATGGGTCCAGGTGGGG - Intronic
1011945984 6:92903884-92903906 AGTATCCATGGGACATGGTAGGG + Intergenic
1012458445 6:99432235-99432257 AGCAGACTTGGGGTCTGGTGAGG - Intergenic
1014809591 6:125870645-125870667 AGTATGCCTGGGGCCTGGAGGGG - Intronic
1017728243 6:157290992-157291014 AGGAGCCAGGGGCCATGGTGGGG - Exonic
1017735249 6:157356937-157356959 AATAGATATTGGGCCTGGTGCGG + Intergenic
1018099997 6:160429078-160429100 AGGAACCAGAGGGCCTGGTGGGG - Intronic
1018176037 6:161180222-161180244 AGGAGCCTTGGGGAATGGTGGGG - Intronic
1018671509 6:166181710-166181732 AGTTGCCATTTGGCCGGGTGCGG - Intergenic
1019239409 6:170652779-170652801 ATTAGCACTGGGGCCTGTTGTGG - Intergenic
1019912352 7:4108213-4108235 AGCTGCCATGGGCCCTGATGGGG + Intronic
1022265846 7:28754132-28754154 AGTAGCATTGTGGCCGGGTGAGG + Intronic
1022965350 7:35466834-35466856 GGTAGCCAGAGGGCCTGGTTTGG + Intergenic
1024975964 7:55113870-55113892 AGCAGCCCTGGAGCCTGCTGGGG + Intronic
1025951621 7:66150094-66150116 ATCAGACATGGGGCCGGGTGCGG - Intronic
1026673433 7:72408966-72408988 AGTATACTTGGGGCCAGGTGTGG - Intronic
1028559652 7:92159909-92159931 AAAAGCAATGGGGCCTGGTGAGG - Intronic
1028791649 7:94860240-94860262 AGTATCCTGTGGGCCTGGTGTGG - Intergenic
1029243014 7:99177873-99177895 AGTATCCAGGGGTCTTGGTGGGG - Intronic
1029250097 7:99230048-99230070 AGTACCTATGGTGCCAGGTGCGG - Intergenic
1029552321 7:101244053-101244075 AGTACGCCTGGTGCCTGGTGCGG - Exonic
1030518931 7:110573157-110573179 AGTAGCACTGGTGTCTGGTGAGG + Intergenic
1030671911 7:112347331-112347353 AGTTGCACTGGGACCTGGTGAGG - Intergenic
1032036900 7:128528173-128528195 AATAATCATTGGGCCTGGTGCGG - Intergenic
1032580447 7:133098806-133098828 AGAGGCCCTGGGGCCAGGTGTGG - Intergenic
1032711290 7:134462798-134462820 AGTGGCAATGGAGACTGGTGAGG - Intergenic
1033825813 7:145187402-145187424 AGTAGCAATAGGGCCAGGTATGG - Intergenic
1033944798 7:146703604-146703626 AGCAGATCTGGGGCCTGGTGAGG + Intronic
1034459760 7:151191889-151191911 GGAAGACATGGGGCCTGGAGGGG + Intronic
1035508361 8:153829-153851 ATTAGCACTGGGGCCTGTTGTGG + Intergenic
1035572490 8:682034-682056 TGTAGCCAAGGGGCAGGGTGGGG - Intronic
1035591180 8:815210-815232 AGGAGGCTTGGGGTCTGGTGAGG + Intergenic
1036710314 8:11074313-11074335 AGTGGCCATGGGGCCATGTGGGG - Intronic
1037100914 8:15044744-15044766 AGTTCCCCTGTGGCCTGGTGAGG + Intronic
1038913800 8:31996895-31996917 AGTAGAGATGGGGCATGGGGTGG - Intronic
1040510002 8:48085012-48085034 AGTACCCCGGGGTCCTGGTGAGG + Intergenic
1044219118 8:89649271-89649293 GGTGGCAATGGGGGCTGGTGGGG - Intergenic
1044425647 8:92046931-92046953 AGTAACCATGAGGCCCAGTGAGG + Intronic
1044552326 8:93526028-93526050 AATAGCCATAGGTCCTGTTGTGG + Intergenic
1044659714 8:94582942-94582964 AGAAGCCAGGTGGCCAGGTGTGG - Intergenic
1044964418 8:97561337-97561359 AAGAGTCATGGGGCCGGGTGCGG + Intergenic
1045120807 8:99032065-99032087 AGTGGTCATGGGGACTGCTGAGG + Intronic
1048071479 8:131026308-131026330 AGTAGATTTGGTGCCTGGTGAGG - Intronic
1048204307 8:132403301-132403323 AGCAGCCATGGGACCAGCTGGGG - Intronic
1048370730 8:133773962-133773984 AGGAACAATGGGGCCAGGTGTGG + Intergenic
1049053953 8:140220381-140220403 GTTAGCCAAGGGGACTGGTGTGG - Intronic
1049689125 8:143951075-143951097 TGGAGCCGTGGGGCCTGGTGGGG - Intronic
1049701199 8:144013663-144013685 AATACACATGGGGCCAGGTGCGG + Intronic
1049994236 9:1019376-1019398 AGTATCCTAGGGGCCTGGCGGGG + Intergenic
1050722561 9:8607352-8607374 AGTAGGAATAGGGCCGGGTGCGG + Intronic
1052868463 9:33481089-33481111 AATAGCCTTTGGGCCAGGTGAGG - Intergenic
1053075931 9:35134790-35134812 AGCAGGAACGGGGCCTGGTGCGG + Intergenic
1056602156 9:88054831-88054853 AGTGGCCATGGGGCAGGATGTGG + Intergenic
1058403428 9:104643445-104643467 AGTAGCCATTCTGACTGGTGTGG - Intergenic
1060652234 9:125338163-125338185 AATACTCATGGGGCCAGGTGCGG - Intronic
1061484899 9:130915258-130915280 AGGAGCCCTGGGGGATGGTGGGG - Intronic
1062406393 9:136398753-136398775 AGTTTCCATGTGGCTTGGTGTGG - Exonic
1062462421 9:136667479-136667501 AGGAGCCAGGGGCCCGGGTGAGG - Intronic
1062549321 9:137078661-137078683 AGTTGCCATGGCCCCAGGTGTGG + Exonic
1062759617 9:138333070-138333092 ATTAGCACTGGGGCCTGTTGTGG - Intergenic
1203600064 Un_KI270748v1:3842-3864 ATTAGCACTGGGGCCTGTTGTGG - Intergenic
1187441355 X:19323575-19323597 AGTATTCTTGGGGCCGGGTGTGG + Intergenic
1188359632 X:29236857-29236879 AGAAGGAATGGGGCCAGGTGCGG - Intronic
1190048656 X:47132845-47132867 AGTAGACTGGGGGCCTGGCGCGG + Intergenic
1191759468 X:64630739-64630761 AGTGGCCATGGGGGCAGGCGTGG + Intergenic
1192202532 X:69075844-69075866 ACTAGCCAGGGAGCCTCGTGAGG - Intergenic
1194966908 X:100298620-100298642 AGTGGCCATGCAGCCTGATGTGG - Intronic
1195374494 X:104213681-104213703 AAAAACAATGGGGCCTGGTGTGG - Intergenic
1195421374 X:104678803-104678825 ATCACCCATGGGGCCTGTTGGGG + Intronic
1197790741 X:130251603-130251625 AGAGGCCATGGGGCCGGGCGCGG + Intronic
1197791273 X:130256423-130256445 AGAGGCCATGGGGCCGGGCGCGG + Intronic
1198536740 X:137594159-137594181 AGCAGCCATGGTGCCCAGTGGGG + Intergenic
1200103330 X:153699329-153699351 AGAAGCCATCAGGGCTGGTGAGG + Intergenic
1201323828 Y:12732630-12732652 AGTAGCCGGGTGGCCAGGTGTGG - Intronic