ID: 1076701428

View in Genome Browser
Species Human (GRCh38)
Location 10:132275233-132275255
Sequence GAGTAGCCATGGGGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701428_1076701437 5 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701428_1076701439 7 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701428_1076701450 28 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701428_1076701435 -5 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701428_1076701447 18 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701428_1076701448 19 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701428_1076701436 2 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701428_1076701441 8 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701428_1076701449 27 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701428_1076701451 29 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701428_1076701434 -6 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701428_1076701445 12 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701428_1076701444 11 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701428_1076701438 6 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701428 Original CRISPR GAGTAGCCATGGGGCCTGGT GGG (reversed) Intronic
No off target data available for this crispr