ID: 1076701429

View in Genome Browser
Species Human (GRCh38)
Location 10:132275234-132275256
Sequence TGAGTAGCCATGGGGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 370}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701429_1076701450 27 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701429_1076701436 1 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701429_1076701447 17 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701429_1076701438 5 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701429_1076701434 -7 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701429_1076701439 6 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701429_1076701448 18 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701429_1076701449 26 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701429_1076701445 11 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701429_1076701451 28 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701429_1076701435 -6 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701429_1076701441 7 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701429_1076701444 10 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701429_1076701437 4 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701429 Original CRISPR TGAGTAGCCATGGGGCCTGG TGG (reversed) Intronic
900381385 1:2385730-2385752 TGTGAGGCCATGTGGCCTGGGGG - Intronic
900536686 1:3182129-3182151 AGAGAAGCCATGAGGCCTGCAGG - Intronic
900841050 1:5048844-5048866 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
902116423 1:14125294-14125316 TGTGTGGCAATGGGGCTTGGGGG + Intergenic
902262401 1:15236533-15236555 TGAGAAGCCATGAGGCCTTTGGG + Intergenic
903914590 1:26754381-26754403 TGACTAGCCACTGGGACTGGTGG + Intronic
905263198 1:36733460-36733482 TGGGGAGCCATGGGGGATGGAGG + Intergenic
905429545 1:37911489-37911511 TGAGTGGCGATTAGGCCTGGTGG - Intronic
905884381 1:41484023-41484045 TGAGCATCCATGGGGATTGGGGG - Intronic
906047904 1:42846781-42846803 TGGGAAGCCAAGGGGCCTTGTGG + Intronic
906379007 1:45319693-45319715 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
907669225 1:56460230-56460252 AGATTAGCCTGGGGGCCTGGGGG - Intergenic
909729754 1:78876662-78876684 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
911147708 1:94568583-94568605 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
911157959 1:94655174-94655196 TGACTAGCGATGGGAGCTGGAGG - Intergenic
912144275 1:106773104-106773126 TGTCTAGCCCTGGGGGCTGGTGG + Intergenic
912452560 1:109776330-109776352 TGGGAAGGCAAGGGGCCTGGAGG + Intergenic
912454862 1:109790665-109790687 GGAGAAGCCATGGGATCTGGAGG + Intergenic
912813840 1:112813432-112813454 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
912977708 1:114345337-114345359 AAAATAGCCATGGGGCATGGGGG + Intergenic
913095459 1:115511899-115511921 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
915084086 1:153372894-153372916 TGAGTAGCCAAGGCTCTTGGTGG - Intergenic
915399423 1:155611556-155611578 TGAGTAGTGATGGTGTCTGGAGG + Exonic
915416536 1:155747136-155747158 TGAGTAGTGATGGTGTCTGGAGG + Intergenic
915427717 1:155841282-155841304 TCAGTAGTCCTTGGGCCTGGAGG - Intronic
915895138 1:159806327-159806349 TGAGTAGTCAAGTGGCCGGGTGG + Intronic
917749934 1:178043960-178043982 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
919664952 1:200282950-200282972 AGAGCTGCCATGGGGCGTGGGGG + Intergenic
920006612 1:202837910-202837932 TGAAGAGCCTGGGGGCCTGGGGG - Intergenic
920090112 1:203446680-203446702 TAAGCAGGCCTGGGGCCTGGGGG + Intergenic
921583990 1:216926834-216926856 TGAGTAGCCAGAGCGCCGGGTGG + Intronic
922935083 1:229416368-229416390 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
923213932 1:231831923-231831945 TGAGTGGCGATTAGGCCTGGTGG + Intronic
923257072 1:232231346-232231368 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
923647579 1:235839624-235839646 TTAGTAGAGATGGGGCGTGGTGG - Intronic
923941665 1:238833473-238833495 TGTGTAGCCACTGGGCATGGAGG + Intergenic
924895918 1:248337949-248337971 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1063160681 10:3416029-3416051 TGAGGATCCATGGGGGATGGGGG + Intergenic
1063970110 10:11375856-11375878 TGACTAGCCATGGGACCTTTGGG - Intergenic
1065367542 10:24951126-24951148 GGAGTAGCCATGTGGACTGCAGG - Intronic
1066103137 10:32135537-32135559 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1069876710 10:71567623-71567645 TGTCTAGCCATGGGGCATGGTGG - Intronic
1071517247 10:86306299-86306321 TGAGTATTCATGGGCTCTGGTGG + Intronic
1072884751 10:99263201-99263223 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1073130646 10:101186940-101186962 TGAGTGGCAATCAGGCCTGGTGG + Intergenic
1073394996 10:103210263-103210285 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1073683772 10:105731211-105731233 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1073719788 10:106154992-106155014 TGAGGAGTCATGGTACCTGGAGG - Intergenic
1074473686 10:113750369-113750391 GGAGTAGCCATGTCACCTGGTGG + Intergenic
1074634340 10:115296126-115296148 TTGGTAGCAATGGGGGCTGGTGG + Intronic
1076407152 10:130220243-130220265 TGAGAGGCCATTGGCCCTGGAGG + Intergenic
1076701429 10:132275234-132275256 TGAGTAGCCATGGGGCCTGGTGG - Intronic
1077743255 11:4871576-4871598 TGTGTAGCCTTTGGTCCTGGGGG + Intronic
1078789316 11:14526827-14526849 TGAGTGGCGATTAGGCCTGGTGG - Intronic
1079115857 11:17640324-17640346 TCAGTGGCCATGCAGCCTGGTGG - Intronic
1079847383 11:25488730-25488752 TGAGCAGCGATTAGGCCTGGTGG + Intergenic
1080746575 11:35113397-35113419 TGAGTATCCATGGAGACTCGTGG + Intergenic
1080774074 11:35369511-35369533 TAAAAAGCCATGGGGCCTTGGGG + Intronic
1081160029 11:39738769-39738791 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1081878699 11:46429242-46429264 TGAGTAGCGATAGGGGCTGGAGG - Intronic
1081910200 11:46695514-46695536 TGGGGAGCCATGTGGCCTAGTGG - Intronic
1083414122 11:62514242-62514264 TAAGTAGCCCTGGTGTCTGGAGG - Intronic
1084752169 11:71211108-71211130 GGAGTAGCCACGGGGCCTGTGGG - Intronic
1086005281 11:82029211-82029233 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1086135981 11:83444422-83444444 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1086550507 11:88047383-88047405 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1086658335 11:89384972-89384994 TGAGTGGCAATTAGGCCTGGTGG - Intronic
1087839239 11:102905592-102905614 TGTGTGGCCATTAGGCCTGGTGG + Intergenic
1088459234 11:110065014-110065036 TGAGGAGCCATGCTCCCTGGAGG - Intergenic
1089034750 11:115376067-115376089 TGAGAAGCCATGTTGCTTGGTGG + Intronic
1089102690 11:115976802-115976824 GGGGTAGCGATGGGACCTGGAGG - Intergenic
1089197388 11:116702292-116702314 TGACTAGCTATGGGACCTTGGGG - Intergenic
1089493885 11:118899085-118899107 TGGGGAGGCATGGGGCCTGGCGG + Exonic
1089760938 11:120722730-120722752 CGTGTAGCCAGGGGGCCTGCTGG - Intronic
1089866781 11:121639641-121639663 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1089953633 11:122551322-122551344 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1089961235 11:122618789-122618811 TGAAAAGCCTTGGGGTCTGGGGG + Intergenic
1090208311 11:124897782-124897804 AGAGTAGCCATGGGCTCTGGAGG - Exonic
1090478567 11:127047263-127047285 TGAGTAAGCGTGGTGCCTGGAGG + Intergenic
1092918131 12:13206624-13206646 TGAACTGCCATGGGGCCTGGCGG - Intronic
1093358753 12:18199318-18199340 TGAGTGGCGATTAGGCCTGGTGG - Intronic
1094826060 12:34269992-34270014 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1095778486 12:46034346-46034368 TGAGTGGCTATTAGGCCTGGTGG - Intergenic
1095806467 12:46325450-46325472 TGAGTAGTGATTAGGCCTGGTGG + Intergenic
1095998716 12:48111634-48111656 TGAGTGGCGATTAGGCCTGGTGG + Intronic
1096123487 12:49103648-49103670 TGAAAAGCCATGCAGCCTGGAGG + Intronic
1096980972 12:55728252-55728274 TGAGTGGCGAGGGGTCCTGGGGG - Intronic
1097541896 12:60953492-60953514 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1100940608 12:99719489-99719511 TGAGTGGCGATTAGGCCTGGTGG - Intronic
1101829894 12:108248984-108249006 TGAGAAGCAGTGTGGCCTGGGGG - Exonic
1102116481 12:110407013-110407035 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1102219762 12:111186539-111186561 TCAGCAACCATGGGTCCTGGTGG - Intronic
1103215274 12:119196929-119196951 TGAGAGGACATGGGGCATGGAGG - Intronic
1103368203 12:120398387-120398409 TAAGTGGCCATGGGGGCAGGAGG - Intergenic
1103401669 12:120647350-120647372 TCAGTAACCATGTGGCCTAGAGG - Intronic
1103826505 12:123743280-123743302 AGAGCAGCCAGAGGGCCTGGAGG - Intronic
1103949238 12:124542256-124542278 TGAGTAATCATGGGTCCTGGAGG - Intronic
1104494661 12:129225862-129225884 TGAGTGGCTGTGGGGGCTGGGGG - Intronic
1104725973 12:131075957-131075979 TGAGCAGCCCTGGGTCCTGGTGG + Intronic
1104978416 12:132562246-132562268 TGGGAAGCCAGGGGGCCTGGAGG - Intronic
1105032546 12:132894066-132894088 TGAGTGGCAATTAGGCCTGGTGG - Intronic
1105443115 13:20431495-20431517 TGAGGGGCCGTGGTGCCTGGAGG - Intronic
1106461463 13:29974000-29974022 AGAGTGGCAGTGGGGCCTGGTGG + Intergenic
1109716474 13:66228100-66228122 TGTGTGGCGATTGGGCCTGGTGG + Intergenic
1110845605 13:80187674-80187696 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1110978743 13:81870174-81870196 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1112520349 13:100089227-100089249 TGAGGAGCAACGGGGCCTCGCGG + Intronic
1112889071 13:104209822-104209844 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1113708518 13:112449122-112449144 TGAGTAGACATGGGGTCCTGCGG + Intergenic
1116023640 14:39490105-39490127 TGAGTGGCCATGCTCCCTGGAGG + Intergenic
1116996537 14:51330578-51330600 TGAGCAGTCATGGGAACTGGGGG + Intergenic
1118298748 14:64595218-64595240 TGAATGGTAATGGGGCCTGGAGG - Intergenic
1118573622 14:67219239-67219261 TTGGTAGCAATGGGGGCTGGTGG + Intronic
1118602006 14:67477424-67477446 AGAGAAGCCTTGGGACCTGGGGG - Intronic
1120539302 14:85734688-85734710 TGAGTGGCGATTAGGCCTGGCGG + Intergenic
1120910020 14:89657933-89657955 TGGGTAGCCATAGCGCCTAGTGG - Intergenic
1121389710 14:93563635-93563657 TGAGTGGCGATTAGGCCTGGTGG + Intronic
1121872580 14:97422634-97422656 TGAGTAACCACAGGGCCTGAAGG + Intergenic
1122286379 14:100655067-100655089 GGAGCAGCCACAGGGCCTGGGGG + Intergenic
1122811894 14:104293346-104293368 GGAGTAGGCCAGGGGCCTGGAGG + Intergenic
1122873323 14:104651258-104651280 TGTGAAGCCATCGGGCCTGTGGG + Intergenic
1123788417 15:23695274-23695296 TGAGTAGTAAGGGGACCTGGTGG - Intergenic
1124246950 15:28079414-28079436 TGTGTGGCCATGTCGCCTGGTGG - Intronic
1124490627 15:30152775-30152797 TGAGTAGACAGGTGTCCTGGTGG - Intergenic
1124752906 15:32385554-32385576 TGAGTAGACAGGTGTCCTGGTGG + Intergenic
1124974651 15:34521254-34521276 TGAGTAGACAGGTGTCCTGGTGG + Intergenic
1125629586 15:41136196-41136218 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1125657210 15:41367721-41367743 GCAGTAGCAATGGGGGCTGGTGG + Intronic
1128080304 15:64853235-64853257 TGAGTGGGGATGAGGCCTGGGGG + Intronic
1129081880 15:73048447-73048469 TGAGCCGCCGAGGGGCCTGGGGG + Intergenic
1129210083 15:74063410-74063432 TGAGTAGACAGGTGTCCTGGTGG + Intergenic
1129403939 15:75301992-75302014 TGAGTAGACAGGTGTCCTGGTGG - Intergenic
1129468934 15:75739446-75739468 TGAGTAGACAGGTGTCCTGGTGG - Intergenic
1129476951 15:75792021-75792043 TGAGTAGACAGGTGTCCTGGTGG - Intergenic
1129842122 15:78750358-78750380 TGAGTAGACAGGTGTCCTGGTGG - Intergenic
1130798863 15:87239926-87239948 AGAGTAGAAATGTGGCCTGGAGG + Intergenic
1131448040 15:92515708-92515730 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1131536271 15:93240419-93240441 TGAGAAGCCATGCTGCCAGGAGG + Intergenic
1131684448 15:94754763-94754785 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1131685012 15:94758674-94758696 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1132340691 15:101076536-101076558 TGTGTGGCCATTAGGCCTGGTGG - Intronic
1133869282 16:9672804-9672826 TGAGTGGCGATTAGGCCTGGTGG + Intronic
1134619708 16:15678263-15678285 TGAGTAGCCATGATGCCAGGAGG + Intronic
1135394884 16:22123550-22123572 TGAGCAACCAAGGGGCCTGAGGG - Intronic
1136246521 16:28979308-28979330 TGAGTGGGCCTGGGGCCTGGGGG + Intronic
1136530232 16:30863195-30863217 TGAGTGGCGATTAGGCCTGGTGG - Intronic
1137055045 16:35741363-35741385 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1137522530 16:49207050-49207072 TGAGTAGCCAAGCGGGGTGGAGG - Intergenic
1137915423 16:52424674-52424696 TCAGTGGCCATGGGGCCTCCGGG - Intergenic
1138758829 16:59519355-59519377 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1138785469 16:59840538-59840560 TGAGTAGCCATGGGGAAGGGAGG + Intergenic
1138805212 16:60082823-60082845 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1139513044 16:67438090-67438112 TGTGTGTCCTTGGGGCCTGGGGG - Exonic
1139593639 16:67946412-67946434 TGTGAAGGCCTGGGGCCTGGTGG - Intronic
1140587262 16:76308479-76308501 GTAGTAGCCATGGTGCCTGACGG - Intronic
1141229447 16:82151322-82151344 TGAGTAGAAATGGTACCTGGTGG + Intronic
1141513000 16:84524801-84524823 TGGGAAGACATGGGGCCTTGTGG + Intronic
1141993110 16:87621514-87621536 GGGGAAGCCCTGGGGCCTGGGGG - Intronic
1143855259 17:9843537-9843559 TGGGAAGCCATGGGGACTTGCGG - Intronic
1145414298 17:22702701-22702723 TGAGCAGCCATGGGGTGGGGGGG + Intergenic
1145937966 17:28726227-28726249 GGAGGAGCCAAGGGGCCTAGAGG - Intronic
1146843353 17:36169261-36169283 GGAGTAGCCTTGGGGTTTGGGGG - Intronic
1146918764 17:36695708-36695730 TGAGAAGCCATAGGGGATGGTGG + Intergenic
1147330363 17:39695770-39695792 TGACCAGCCATGGAGACTGGGGG - Intronic
1147582787 17:41636495-41636517 GCAGTAGCAAAGGGGCCTGGGGG - Intergenic
1148356849 17:46980994-46981016 TGAGTAGCGAAGGGGGGTGGGGG + Intronic
1152238622 17:79150810-79150832 TGACTGGCCATGGGGCCTCAGGG + Intronic
1152454256 17:80403951-80403973 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1152854967 17:82659482-82659504 TGGGTACCCATGAGCCCTGGAGG + Intronic
1152928705 17:83099472-83099494 AGGGGAGGCATGGGGCCTGGTGG - Intergenic
1153881384 18:9424610-9424632 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1155316895 18:24580831-24580853 TTACTAGTCATGTGGCCTGGGGG + Intergenic
1155892504 18:31286453-31286475 TGAGTGGCGATGAGGCCTGGTGG + Intergenic
1155941812 18:31807795-31807817 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1155962253 18:32004444-32004466 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1156251633 18:35357833-35357855 TGTGTAGCGATTAGGCCTGGTGG + Intergenic
1156923851 18:42554628-42554650 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1158215622 18:55097708-55097730 TGAATCTCCAGGGGGCCTGGAGG - Intergenic
1160716888 19:580784-580806 TGAGAAGCCAAGGAGGCTGGGGG + Intronic
1160786324 19:901592-901614 TGGGTCCCCATGGTGCCTGGGGG - Intronic
1161239029 19:3211510-3211532 TGTGTGGCCCTGGGGCATGGGGG + Intergenic
1161409455 19:4108794-4108816 TGAGTAGCGAGGGTGCCTGCCGG + Intronic
1161857157 19:6772634-6772656 GGAGGAGCCATGGGGCGGGGGGG - Intergenic
1162384511 19:10353165-10353187 TGAGCAGCCAGGAGGGCTGGGGG + Intronic
1162761946 19:12893659-12893681 TGGCTGCCCATGGGGCCTGGTGG + Intronic
1162796620 19:13090569-13090591 TGATTAGCCAGGGAGCCTGGGGG - Intronic
1163723155 19:18907714-18907736 TCAATAGCCATGGGGAATGGAGG - Intronic
1163944194 19:20520837-20520859 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1165406474 19:35633996-35634018 TCAAGAGCCATGAGGCCTGGGGG - Exonic
1167741620 19:51327539-51327561 TGAGAGGCCAGGGTGCCTGGAGG + Intronic
1167796711 19:51714075-51714097 TGAGTAGCAGCGGGACCTGGAGG + Exonic
1167901434 19:52625093-52625115 TGAGTGGCGATTAGGCCTGGTGG - Intronic
1168211862 19:54896610-54896632 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
927194387 2:20537721-20537743 TGAGAGGCCATCAGGCCTGGGGG - Intergenic
927987732 2:27424829-27424851 TTAGTAGAGATGGGGCATGGTGG - Intergenic
928200788 2:29246487-29246509 TGAGTAACCATGGTGTCTAGAGG - Intronic
928228588 2:29476598-29476620 TGAGTAGCCCTGAGACCCGGGGG + Intronic
928579899 2:32696909-32696931 TGAGTAGCCGATGGGCGTGGTGG + Intronic
929383870 2:41382303-41382325 TGATTGGCGATTGGGCCTGGTGG - Intergenic
930053478 2:47234789-47234811 TGTGAAGCAATGGGGTCTGGCGG - Intergenic
930706430 2:54509130-54509152 TGAGTGGCGATTAGGCCTGGTGG + Intronic
932456984 2:71856199-71856221 TGAGTAGACATGGAACATGGAGG + Intergenic
932716067 2:74101381-74101403 TGAGAAGCCGTGGGCGCTGGGGG + Exonic
933179517 2:79213560-79213582 TGAGTGGCGATTAGGCCTGGTGG + Intronic
934160303 2:89243410-89243432 TGTGTAGCCTTGGGGATTGGGGG - Intergenic
934206972 2:89939023-89939045 TGTGTAGCCTTGGGGATTGGGGG + Intergenic
934919788 2:98333594-98333616 TGAGAAGACATGAGCCCTGGTGG - Intronic
936794028 2:116185979-116186001 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
937594704 2:123659674-123659696 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
938192370 2:129295342-129295364 TGAGTAGCAATGGGGCTAAGGGG + Intergenic
939460481 2:142491561-142491583 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
940183231 2:150957041-150957063 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
941455872 2:165711838-165711860 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
941750881 2:169134539-169134561 TGAGTGGCGATTAGGCCTGGTGG - Intronic
941782410 2:169459405-169459427 GGAGAAGCCACGGGGCCAGGTGG - Intergenic
942802588 2:179892760-179892782 TGAGTGGGCATAGGGTCTGGTGG - Intergenic
943412663 2:187562201-187562223 TGAGTAGCGATTAGGCCTGGTGG + Intronic
944387712 2:199183367-199183389 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
945376367 2:209082066-209082088 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
945858445 2:215093957-215093979 TGAGTAGCTATTAGGCCTGGTGG - Intronic
946020032 2:216634334-216634356 TGAGGACCCAAGGGTCCTGGTGG + Intronic
946819285 2:223613619-223613641 TTAGTAGCCAAGAGGTCTGGGGG - Intergenic
947006273 2:225514786-225514808 AGAGAAGCTATGGGACCTGGTGG - Intronic
947598826 2:231431975-231431997 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
948169530 2:235889934-235889956 TGAGCAGATCTGGGGCCTGGAGG - Intronic
948290877 2:236823469-236823491 TGATGAGCCAGGGGCCCTGGAGG + Intergenic
948578439 2:238968837-238968859 GGAGTAGCCCTGTGCCCTGGGGG + Intergenic
1168760793 20:348143-348165 GGAGAAGAAATGGGGCCTGGGGG - Intronic
1168943015 20:1729474-1729496 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1171149037 20:22810643-22810665 TGAGAAACAATGGGGCCTGGGGG - Intergenic
1173998161 20:47355842-47355864 GGAGTAGGGATGGGGACTGGGGG - Intronic
1175216286 20:57393032-57393054 GAAGTGGCCATGGGGCCTGGAGG + Intronic
1175920958 20:62450530-62450552 TGGGAAGCCATGGGGACTGCAGG - Intergenic
1176685914 21:9848400-9848422 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1177119837 21:17125484-17125506 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1179551774 21:42147836-42147858 AGGGGAGCCATGGGTCCTGGGGG + Intergenic
1179712894 21:43273339-43273361 TGGGAGGCCATGGGGCCTTGAGG - Intergenic
1180142964 21:45903495-45903517 TGTGCATCCCTGGGGCCTGGTGG + Intronic
1181909690 22:26228786-26228808 TGAATAGCCGTGGGACCTCGTGG - Intronic
1182360846 22:29745555-29745577 TAAGTAGGCATGGTGCCTGTGGG - Intronic
1182671577 22:32000613-32000635 TTAGTAGCCAAGGGGCAGGGTGG + Intergenic
1184927467 22:47653264-47653286 GGAAGAGCCATGGGGCATGGTGG + Intergenic
949960411 3:9307350-9307372 TGAACAGCCAGGGGTCCTGGGGG + Intronic
950430725 3:12949501-12949523 GGGGAAGCCATGAGGCCTGGAGG - Intronic
951894881 3:27601127-27601149 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
952019880 3:29005415-29005437 TGAGTAGTCATGGGGCTAGTAGG + Intergenic
952297196 3:32071947-32071969 TGAGTGGCAATTAGGCCTGGTGG - Intronic
952894902 3:38072005-38072027 TGAGTGGCAATTAGGCCTGGTGG + Intronic
953656239 3:44857021-44857043 TGAGTGGCAATTAGGCCTGGTGG + Intronic
954161463 3:48725824-48725846 TGAGTGGCAATTAGGCCTGGTGG + Intronic
954323535 3:49848358-49848380 TGAGTACCCATCAGGCCTTGCGG - Intronic
954446080 3:50547582-50547604 CGACTAGCCTTGGGGGCTGGGGG + Intergenic
956122377 3:65979097-65979119 TGAGTAGCTGTGGGGGGTGGCGG - Intronic
957451707 3:80388858-80388880 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
958183133 3:90085057-90085079 TGAGTGGCTATTAGGCCTGGTGG - Intergenic
958676533 3:97274693-97274715 TGAGTGGCAATTAGGCCTGGTGG + Intronic
960019314 3:112931983-112932005 TCAGTAGCTATAGGGGCTGGTGG - Intronic
962021952 3:131511113-131511135 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
962452010 3:135527716-135527738 TGAGTAGCAATGTGGCATAGTGG + Intergenic
962476997 3:135763561-135763583 TGGGCAGCCATGGGCCATGGTGG - Intergenic
963468871 3:145714389-145714411 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
963521918 3:146366261-146366283 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
964125192 3:153228402-153228424 TGAGTAGCGATTAGGCCTGGTGG + Intergenic
964299963 3:155276686-155276708 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
965070612 3:163911735-163911757 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
965335417 3:167426965-167426987 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
965639715 3:170819300-170819322 TGAGTGGCGATTAGGCCTGGTGG + Intronic
965861692 3:173157470-173157492 TGAGTAGCGATTAGGCCTGGTGG + Intergenic
966398163 3:179522653-179522675 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
967222895 3:187263450-187263472 TGAGTAGCCAGGGAGTCTGTGGG + Intronic
967424772 3:189314329-189314351 TGAGTAGTCATGGGGCTGGTGGG + Intronic
968412950 4:405081-405103 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
968650728 4:1759302-1759324 TGAGCTGCCCTGTGGCCTGGGGG - Intergenic
968787111 4:2630881-2630903 AGAGCACCCATGGGCCCTGGTGG + Intronic
969648366 4:8447564-8447586 TGAGTAGACAGAGGGCCAGGAGG - Intronic
972084492 4:35198131-35198153 TGAGTCTCCATGGAGCCTGTAGG + Intergenic
973751376 4:54023636-54023658 TGAGTGGCGATTAGGCCTGGTGG - Intronic
974173160 4:58293043-58293065 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
974904094 4:68034979-68035001 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
975737223 4:77393024-77393046 TGAGTATCCGTGGGACCTTGTGG - Intronic
976616928 4:87087481-87087503 ACAGTAGCTGTGGGGCCTGGAGG + Intronic
976739640 4:88345100-88345122 TGAGTGGCGATTTGGCCTGGTGG + Intergenic
977198172 4:94086345-94086367 TGTGTGGCCATTAGGCCTGGTGG + Intergenic
977518845 4:98056002-98056024 GGAGTTGCCATGGGCTCTGGGGG - Intronic
979501747 4:121448356-121448378 AGAGTAGGCATGGAGCCAGGAGG + Intergenic
980349372 4:131666878-131666900 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
980528117 4:134016117-134016139 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
982396466 4:154920570-154920592 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
982668124 4:158291375-158291397 TGGGAGGCCATGGGGCCTCGGGG + Intergenic
982720127 4:158850618-158850640 AGAGTAGCAGTGGGGGCTGGAGG + Intronic
984098746 4:175462903-175462925 TGTGTAGCGATTAGGCCTGGTGG + Intergenic
984437556 4:179724644-179724666 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
985634589 5:1029884-1029906 TGAGGTGCCCTGGGGCCTGAGGG - Intronic
985671158 5:1207308-1207330 TGTGTAGCCTGGGGGCCTTGTGG + Intronic
985725158 5:1512248-1512270 TGATTGGACATGGGGCATGGAGG - Intronic
985881448 5:2641748-2641770 CCAGAAGCAATGGGGCCTGGTGG + Intergenic
989614874 5:43329506-43329528 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
990564878 5:57018866-57018888 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
993477735 5:88385776-88385798 TGAAAAGACATGGGCCCTGGAGG - Intergenic
994125836 5:96168603-96168625 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
994778693 5:104065915-104065937 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
995831508 5:116360473-116360495 CGAGAAGCCATGGGCCCTGTGGG - Intronic
996917927 5:128733324-128733346 TGAGTGGCAATTAGGCCTGGTGG - Intronic
997610005 5:135209232-135209254 GGAGAAGCCATGGGGACAGGAGG + Intronic
997678541 5:135733240-135733262 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
998094636 5:139390368-139390390 TGAGTGGCCAGGGAGCCTTGGGG - Intergenic
998595064 5:143520972-143520994 TGAGCTGCCATGGTGGCTGGCGG + Intergenic
999278270 5:150346886-150346908 TGAGTGGCCATGGTGTATGGAGG + Intergenic
1000231236 5:159317079-159317101 TGAGTGGCCATGGGGTCTTGAGG - Intronic
1000438822 5:161243963-161243985 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1000440005 5:161252694-161252716 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1002573760 5:180160051-180160073 TGAGCAGCCATGAGCCCTGGAGG - Intronic
1002931384 6:1637344-1637366 TGAGGAGGCAGGTGGCCTGGAGG + Intronic
1002972658 6:2040127-2040149 TGAGGAGCCATTGGGCTTAGAGG - Intronic
1003100066 6:3170230-3170252 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1004356456 6:14933571-14933593 GGAAAAGCAATGGGGCCTGGTGG + Intergenic
1006376979 6:33677091-33677113 TGAGTGGCCAAGGGTCCTCGGGG + Intronic
1006496300 6:34425887-34425909 TGAGTAGCGATAGGGGCTGGAGG - Exonic
1007084436 6:39133467-39133489 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1007425410 6:41743247-41743269 TGAGTGGGCATGGGGAGTGGAGG - Intronic
1007706707 6:43795554-43795576 TCCGAAGTCATGGGGCCTGGAGG - Intergenic
1010829440 6:80512032-80512054 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1013520401 6:110927451-110927473 TTAGAAGCAATGGGGCCTTGAGG + Intergenic
1015801089 6:137062837-137062859 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1017270109 6:152494469-152494491 TGAGTGGCAATTAGGCCTGGTGG - Intronic
1017922556 6:158884907-158884929 TGAGTGGCAATTAGGCCTGGTGG + Intronic
1018030167 6:159835441-159835463 TGAGAAGCCAAGAGGCCTGGAGG + Intergenic
1018136020 6:160779082-160779104 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1019449729 7:1091179-1091201 TGAGCAGCCGTGGGACCTGCAGG + Intronic
1020276923 7:6630200-6630222 TGAGTGGCCACTGGGGCTGGGGG + Intergenic
1020540840 7:9460054-9460076 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1021200737 7:17726445-17726467 CGAGTGGCCAAGGGCCCTGGAGG - Intergenic
1021430109 7:20549433-20549455 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1023209304 7:37785906-37785928 TAAGTAGCCCTGTGGCCTTGTGG + Intronic
1024561513 7:50648966-50648988 TGAGTGGCCACGGGACTTGGGGG + Intronic
1024738955 7:52335213-52335235 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1025998178 7:66541673-66541695 TGGGTACCCAGGGGGGCTGGTGG + Intergenic
1026159386 7:67855372-67855394 TGAGTAAAAATGGGGCCTGGGGG + Intergenic
1027158637 7:75786295-75786317 TGAGTGGCGATCAGGCCTGGTGG - Intronic
1028197666 7:87926204-87926226 TTACTCGCCATGGGGTCTGGGGG + Intergenic
1028589582 7:92481123-92481145 TGAGTGGCGATCAGGCCTGGTGG + Intergenic
1031777631 7:125921777-125921799 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1032229148 7:130059367-130059389 TCACTAGCCATGTGGCCTTGGGG + Intergenic
1033625822 7:143108652-143108674 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1034311739 7:150094764-150094786 TGAGTGGCCATGGGGAATGGCGG + Intergenic
1034795114 7:154005890-154005912 TGAGTGGCCATGGGGAATGGCGG - Intronic
1035261194 7:157662634-157662656 TGAGCAGGCATGGGGCCTGGAGG + Intronic
1036185042 8:6615271-6615293 TGAGTAGGCTTGGGGCATTGAGG - Intronic
1036549970 8:9807089-9807111 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1037487736 8:19364363-19364385 TGAGCTGCCATGGGGTGTGGAGG + Intronic
1038379043 8:27075087-27075109 AGAGTTGCCATGGGAGCTGGAGG + Intergenic
1040304248 8:46203818-46203840 AGAGTAGCCATGGGGGCTTCTGG - Intergenic
1041792867 8:61715626-61715648 TGAAAAGGCATGGGGCCGGGGGG - Intergenic
1043837988 8:85066921-85066943 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1048135749 8:131744920-131744942 TGTGTGGCAATTGGGCCTGGTGG - Intergenic
1049310126 8:141929463-141929485 TGAGGAGCTCTGGGGCCTGCTGG - Intergenic
1049460895 8:142727249-142727271 TGAGTTCCCAGGAGGCCTGGCGG + Exonic
1049994234 9:1019374-1019396 TGAGTATCCTAGGGGCCTGGCGG + Intergenic
1052163367 9:25291883-25291905 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1052192086 9:25672911-25672933 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1052653607 9:31330399-31330421 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1053058322 9:35007688-35007710 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1053544521 9:39009354-39009376 TGAGCTGGCCTGGGGCCTGGAGG - Intergenic
1053783401 9:41633198-41633220 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1053808953 9:41832836-41832858 TGAGCTGGCCTGGGGCCTGGAGG - Intergenic
1054171355 9:61843340-61843362 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1054621639 9:67354592-67354614 TGAGCTGGCCTGGGGCCTGGAGG + Intergenic
1054666179 9:67737472-67737494 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1055551339 9:77434626-77434648 TCACTAGGCATGGGGCGTGGTGG + Intronic
1055881990 9:81013003-81013025 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1056324147 9:85462640-85462662 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1057211496 9:93203228-93203250 TGAGGCCCCCTGGGGCCTGGTGG + Intronic
1057235105 9:93351605-93351627 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1058683449 9:107459947-107459969 AGATTAGCCATGGGACCTTGTGG - Intergenic
1059318579 9:113448321-113448343 TGAGTGGCAATGGGGCTGGGGGG - Intronic
1060827215 9:126694071-126694093 AGAGAAGCCATGGGGACTAGGGG + Intronic
1061910080 9:133717692-133717714 TGAGTAGGGAAGGGGCATGGTGG - Intronic
1062117888 9:134818887-134818909 TGACTCACCATGGGGCCGGGGGG - Exonic
1062155715 9:135047057-135047079 TGGGCAGCACTGGGGCCTGGGGG + Intergenic
1062692285 9:137848477-137848499 TGAGTGGCAATTAGGCCTGGTGG - Intronic
1187103512 X:16218699-16218721 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1188300809 X:28504277-28504299 TGAGTGGCAATTAGGCCTGGTGG - Intergenic
1188332744 X:28894335-28894357 TGAGTGGCGATTAGGCCTGGTGG + Intronic
1188419805 X:29979535-29979557 TGTGTGGCCATTAGGCCTGGTGG - Intergenic
1188552962 X:31381704-31381726 TGTGTGGCCATTAGGCCTGGTGG - Intronic
1189247158 X:39572107-39572129 TGAGGAGCTATGAGGCCTGGAGG + Intergenic
1191761604 X:64653270-64653292 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1191825876 X:65364103-65364125 TGTGTAGCGATTAGGCCTGGTGG - Intergenic
1192706416 X:73531671-73531693 TGAGTGGCGATTAGGCCTGGTGG - Intergenic
1192913842 X:75633861-75633883 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1193403682 X:81076907-81076929 TGATTAGGCATGGGGTGTGGAGG + Intergenic
1193624458 X:83799584-83799606 TGAGAAGTCAGGGGGCATGGAGG + Intergenic
1194011675 X:88569612-88569634 TGGGTAGCCAAGGGGTCTCGGGG - Intergenic
1194660978 X:96628235-96628257 TGAGTGGCGATTAGGCCTGGCGG - Intergenic
1195072423 X:101293079-101293101 TGTGTAGTCATGTGACCTGGAGG + Intergenic
1195927330 X:110038839-110038861 TGAGTTACCATGGGGCGGGGGGG + Intronic
1196822032 X:119709231-119709253 TGCGGAGACATGGGGCATGGGGG + Intergenic
1198146703 X:133864520-133864542 TGAGCAGTGATGGGGCCAGGTGG - Intronic
1201061433 Y:10050190-10050212 TGAGTGGCAATTAGGCCTGGTGG + Intergenic
1201307228 Y:12561463-12561485 TGAGTGGCGATTAGGCCTGGTGG + Intergenic
1201891501 Y:18948061-18948083 TGAGTGGCAATTAGGCCTGGTGG + Intergenic