ID: 1076701430

View in Genome Browser
Species Human (GRCh38)
Location 10:132275237-132275259
Sequence CTGTGAGTAGCCATGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 220}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701430_1076701445 8 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701430_1076701451 25 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701430_1076701435 -9 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701435 10:132275251-132275273 TACTCACAGACAGCCCCACAGGG No data
1076701430_1076701448 15 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701430_1076701436 -2 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701430_1076701441 4 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701430_1076701437 1 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701430_1076701449 23 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701430_1076701450 24 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701430_1076701444 7 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701430_1076701447 14 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701430_1076701439 3 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701430_1076701434 -10 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701430_1076701438 2 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701430 Original CRISPR CTGTGAGTAGCCATGGGGCC TGG (reversed) Intronic
900098161 1:948789-948811 CTGTGTGGGGCCATGGGGCTGGG - Intronic
900183010 1:1320670-1320692 CTGTGAGCAGCCAGGGGTCCTGG - Intronic
900423303 1:2564901-2564923 CTGGGAGGAGCCATGGATCCTGG + Intronic
901088168 1:6624882-6624904 CTGTGAGTGGCTATGCGTCCTGG + Exonic
901193311 1:7425430-7425452 CTGTGAATGGCGATGGGGGCAGG + Intronic
901207051 1:7503392-7503414 CAGTGAGCAGCCTTGGGTCCTGG + Intronic
903134252 1:21298931-21298953 CTGTGGGTAGCCCTGGAGTCAGG - Intronic
903559026 1:24214167-24214189 CTGTGAGGCCCCATGGGACCTGG + Intergenic
908459652 1:64337003-64337025 CAGTGAGAAGCCCTGGGGCAGGG - Intergenic
912527073 1:110291414-110291436 CTCAGAGTTGCCCTGGGGCCAGG + Intergenic
913139084 1:115922577-115922599 CTCAGAGAAGCCTTGGGGCCCGG + Intergenic
917431650 1:174975526-174975548 GTGTGAGTGGCCATGTGGGCAGG + Intronic
919944654 1:202310356-202310378 CTGTGAGTGACCAGGGGCCCTGG + Exonic
920218564 1:204378455-204378477 CTGTGAGCAGCGAGGGGCCCGGG + Intergenic
924612682 1:245587074-245587096 CTGCAAGTAGCCATGGGGCTTGG - Intronic
1062799467 10:368644-368666 CTGTGAGACTCCATGGGGCGAGG + Intronic
1064042735 10:11982424-11982446 CAGTGAGGAGCCAGTGGGCCTGG - Intronic
1069614265 10:69796933-69796955 CTGTGAGTTCCCAGGGGGCAGGG - Intergenic
1069907072 10:71738311-71738333 CTGCTAGGAGCCATGGGCCCAGG + Intronic
1070646566 10:78205942-78205964 CAGAGAGTAGCCACAGGGCCAGG + Intergenic
1071399731 10:85257413-85257435 ATCTGAGTAGCAATGGGGCATGG - Intergenic
1073118995 10:101110043-101110065 CTGTCAGTAGCCATGCTGCCTGG + Intronic
1073380313 10:103073144-103073166 CAGAGGGTGGCCATGGGGCCAGG + Intronic
1073435238 10:103512332-103512354 CTATGTGTAGCCATGAGGCAAGG + Intronic
1074901346 10:117818701-117818723 CTGTGCCAAGCCATGGGCCCAGG - Intergenic
1075590501 10:123687859-123687881 CTGGGAGTGGCCATGGGCCAGGG - Intronic
1076613892 10:131743723-131743745 CTGAAAGTCGCCATGGGGCAGGG + Intergenic
1076701430 10:132275237-132275259 CTGTGAGTAGCCATGGGGCCTGG - Intronic
1076873490 10:133204911-133204933 CTGTGAGGTGCCACGGGGCAGGG - Intronic
1077024704 11:433941-433963 CAGGGAGGAGGCATGGGGCCAGG + Intronic
1077222073 11:1422226-1422248 CTGTGAGCTGCGATGAGGCCTGG - Intronic
1077378457 11:2216386-2216408 CTGGGAGCAGCCCTGGGGCCTGG - Intergenic
1078067816 11:8089660-8089682 AGGTGAGTAGGCCTGGGGCCGGG + Exonic
1078428071 11:11267407-11267429 CTGTGCATGGCCATGGGTCCTGG + Intergenic
1078823286 11:14904780-14904802 CTGTCAGAAGCCAGTGGGCCAGG - Intergenic
1082869739 11:57933271-57933293 CTGAGAGGAGGTATGGGGCCTGG + Intergenic
1084155457 11:67310481-67310503 CTGGGAGGACCCAGGGGGCCTGG + Intronic
1084536353 11:69759595-69759617 CTGTGAGTGGCCCTGGTGACAGG + Intergenic
1084935703 11:72585505-72585527 CTGTGTGTGGGCATGGGGGCTGG - Intronic
1085406777 11:76267965-76267987 CTGTGTGTGCACATGGGGCCAGG + Intergenic
1085696332 11:78707952-78707974 CTGTCAGTAACCAGGGTGCCTGG - Intronic
1086509727 11:87543421-87543443 CTGTGTGCAGCCTTGGGACCTGG - Intergenic
1088459235 11:110065017-110065039 CTGTGAGGAGCCATGCTCCCTGG - Intergenic
1088513412 11:110600480-110600502 GTGTGAGTGAGCATGGGGCCTGG - Intronic
1088973193 11:114791433-114791455 CTGTGACTAGGTAAGGGGCCAGG - Intergenic
1089055187 11:115579630-115579652 CTGTGATTAGCCATGGTGCTTGG - Intergenic
1090208312 11:124897785-124897807 CTGAGAGTAGCCATGGGCTCTGG - Exonic
1090469743 11:126969524-126969546 CTGTGGGTAGCAATGGAGCATGG + Intronic
1092011122 12:5113445-5113467 CAGTGAGTGCCCTTGGGGCCTGG + Intergenic
1092154333 12:6272733-6272755 CACTGTGTAGACATGGGGCCTGG - Intergenic
1094734829 12:33222859-33222881 CTGGGAGTTGCCGTGGGCCCGGG + Intergenic
1094824052 12:34253702-34253724 TTTTTAGTAGCGATGGGGCCAGG + Intergenic
1095552509 12:43459378-43459400 CTGTTAGAAGCCATGGGTCATGG - Intronic
1096459994 12:51816974-51816996 CTGTGTGCAGACATTGGGCCTGG - Intergenic
1096928290 12:55173515-55173537 CTGTGTGGAGCCCTTGGGCCAGG - Intergenic
1098030012 12:66243719-66243741 CTGTGGGTGGTCATGGAGCCAGG + Intronic
1100011213 12:89955614-89955636 CTGAGAGTACCCATCTGGCCTGG + Intergenic
1100979795 12:100155154-100155176 CTATGGGTGACCATGGGGCCTGG - Intergenic
1103340974 12:120221045-120221067 CTGTGGGAAACCATGGGGCCAGG - Intronic
1103700053 12:122844576-122844598 CTGTGAGTGGCTGTGGGACCAGG - Intronic
1103721136 12:122976211-122976233 GTGTGAGGAGCCCAGGGGCCTGG - Intronic
1104494664 12:129225865-129225887 CTGTGAGTGGCTGTGGGGGCTGG - Intronic
1104598828 12:130138803-130138825 CTGTGACTGGACATGGGGCGGGG + Intergenic
1104725972 12:131075954-131075976 CTCTGAGCAGCCCTGGGTCCTGG + Intronic
1104770276 12:131357345-131357367 CTGTGGGTTGCCATGGTGACAGG + Intergenic
1104903965 12:132203760-132203782 CCGTGAGAGGCCAAGGGGCCCGG + Intronic
1105882455 13:24616250-24616272 CAGTGAGTAGTTATGGAGCCTGG - Intergenic
1106080354 13:26495655-26495677 TTTTTAGTAGCCATGGGCCCTGG + Intergenic
1108326491 13:49337460-49337482 CTGGAAGCAGCCATGTGGCCAGG - Intronic
1109769419 13:66951618-66951640 CTGTTAGAAGCGATGGGCCCTGG - Intronic
1115609083 14:35034640-35034662 CTGTGTGCAGCCTTGGGACCTGG - Intergenic
1115797023 14:36949568-36949590 CTTTGAGTAGGCATGGGGCCAGG - Intronic
1116670053 14:47829178-47829200 CTGTGTGCAGCCTTGGGACCTGG - Intergenic
1118858285 14:69641158-69641180 CTAAAAGTAGCCATGGGGCAGGG - Intronic
1119212192 14:72840430-72840452 CTGTGAGTAGCCATGTGGGAGGG - Intronic
1119783856 14:77297899-77297921 CTTTGAGCAGCCAGGAGGCCAGG - Intronic
1121117298 14:91352785-91352807 CGGTGAGCAGGCATGGAGCCAGG + Intronic
1121301538 14:92875485-92875507 CTCCAAGTAGCCATGGGTCCAGG - Intergenic
1122135773 14:99632010-99632032 CTGGGAGTGGACATGGGGCAGGG + Intergenic
1122460445 14:101890150-101890172 CTAGGAGGAGCCATGGAGCCAGG - Intronic
1122893682 14:104744789-104744811 CTGTGGAAAGCCAAGGGGCCGGG - Intronic
1124641373 15:31398530-31398552 CTGGGAGTACCCTGGGGGCCAGG - Intronic
1125794303 15:42393070-42393092 CTCTGGGTAGCCACGGGGACTGG + Intronic
1127365543 15:58285705-58285727 TTGGGTGTGGCCATGGGGCCTGG - Intronic
1128801150 15:70497978-70498000 CTGTGGGCAGCAAGGGGGCCAGG - Intergenic
1130407363 15:83613808-83613830 CAGCCAGTAGCCCTGGGGCCAGG + Intronic
1131568202 15:93505733-93505755 CTGTGTGTAGCCATGCGTGCTGG + Intergenic
1132515299 16:363247-363269 CTGGGTGTGGCCATGTGGCCAGG + Intergenic
1132522682 16:398744-398766 CTGGGAGGAGCCATGGCCCCTGG + Intronic
1132659244 16:1054188-1054210 CTGGGAGCAGCCAAGTGGCCAGG + Intergenic
1132693825 16:1193350-1193372 CTGGGAGAGGCCAAGGGGCCTGG + Intronic
1132796179 16:1724346-1724368 CAGTGAGGAGCCATGAGGGCAGG - Intronic
1132983075 16:2749202-2749224 CTGGGAGCACACATGGGGCCTGG + Intergenic
1133029006 16:3000888-3000910 CTGTGGGTAGACCTGGGCCCAGG - Intergenic
1133089310 16:3391176-3391198 CTGTGAGTGGCCCATGGGCCTGG + Intronic
1133980706 16:10631334-10631356 CTGTGGGAAGCCATGGGGTGGGG + Intronic
1134059931 16:11193052-11193074 CTGTGAGTAGCCACTGAGCCTGG - Intergenic
1135383259 16:22011026-22011048 CTGTGAGTTGCCATGGAGATAGG + Intronic
1137574995 16:49593676-49593698 CTGTGAGCAGGCTTGGGGCTTGG - Intronic
1138188777 16:54997581-54997603 CTGTGAGTAGGCACAGGGCTGGG + Intergenic
1138292762 16:55861988-55862010 CTGTGAGTGGGCCTGGGGCTTGG - Intronic
1138882330 16:61031149-61031171 CAGTGAGGAGGGATGGGGCCAGG + Intergenic
1139952350 16:70678512-70678534 CTGGGTGTTGCCCTGGGGCCAGG + Intronic
1142027075 16:87820084-87820106 TTGTGAGGAGCCAGGGGTCCGGG + Intergenic
1144072630 17:11688491-11688513 CTGTGAGTGGCCATGAAGACTGG - Intronic
1145216938 17:21059965-21059987 GTGTGAGCAAGCATGGGGCCCGG + Intergenic
1145396156 17:22496651-22496673 CTGGGAATTGCCATGGGGCAGGG + Intergenic
1147249373 17:39143967-39143989 CTGCAAGCAGCCCTGGGGCCTGG + Intronic
1147453281 17:40519321-40519343 CTGTGACTGGAAATGGGGCCGGG + Intergenic
1147628015 17:41912399-41912421 CAGTGAGTGGGCATGGGGTCAGG - Exonic
1151508085 17:74542355-74542377 CTGCGAGGAGCCTTGGGACCTGG - Intronic
1151620810 17:75243768-75243790 CTGTGGATAGGCAGGGGGCCAGG + Intronic
1151670452 17:75569179-75569201 CTGTGAGCAGCCACGGGGACAGG - Intronic
1152281110 17:79385305-79385327 CTGGTAGTGGACATGGGGCCTGG - Intronic
1152358918 17:79821129-79821151 CTGTGAGCAGCCCTGGGCCAGGG + Intergenic
1152487482 17:80603700-80603722 CTGTGAGCCTCCATGGGGGCGGG - Intronic
1157675537 18:49565877-49565899 CTATGAGTAGCCAGCTGGCCTGG + Intronic
1157732689 18:50018121-50018143 CTGTGAATAGCCATCCAGCCTGG - Intronic
1157808994 18:50679807-50679829 CTGTGAGCAGAGATGGGGCCAGG + Intronic
1160085216 18:75771119-75771141 CTGTGTGTGGCCCTGAGGCCTGG - Intergenic
1160507511 18:79435528-79435550 CTGTGAGTAGCGCCGGTGCCTGG + Intronic
1160743577 19:699337-699359 CAGTGAGGAGCCAGGGGGCCGGG + Intergenic
1162490329 19:10987643-10987665 CTGGGAGAAGGCAAGGGGCCAGG - Intronic
1162817942 19:13207601-13207623 CCGGTAGTAGCCATGGTGCCGGG + Exonic
1163944841 19:20525673-20525695 CTTTTAGTAGAGATGGGGCCAGG + Intergenic
1164525257 19:29008791-29008813 CTTGGAGCAGCCAAGGGGCCTGG + Intergenic
1165449470 19:35873836-35873858 CTGCATGTAGGCATGGGGCCAGG - Intronic
1166384165 19:42370897-42370919 CTGGGAGTAGCTCTGGAGCCAGG + Intronic
931407590 2:61994924-61994946 CTGCTAGTGGCCATGGGGACTGG - Intronic
932134166 2:69213987-69214009 CTGTGGGTTGCCCTGGGGGCTGG - Intronic
935682141 2:105647361-105647383 CTGTGAATAGCCGTGGGCACTGG - Intergenic
936462775 2:112724527-112724549 CTGTGAGGAGCTCTGGAGCCTGG + Intronic
937375327 2:121332383-121332405 GTGTGTGTAGACAGGGGGCCAGG + Intergenic
937660208 2:124422025-124422047 CTGTTAGTAGACAAGGTGCCTGG - Intronic
937804515 2:126123228-126123250 CTGGGATTAGCCATTGTGCCTGG + Intergenic
937982181 2:127622254-127622276 CTGTGAGTGCCCCTGGGGCTCGG + Intronic
940119866 2:150252591-150252613 CTGTGAGTAGGCATGGGAAGGGG + Intergenic
942038985 2:172039386-172039408 CTGGGAGTAACCCTGAGGCCTGG - Intronic
946349395 2:219139433-219139455 CTGTGAGTAGCCCTATGGACAGG + Intronic
947774580 2:232697518-232697540 CTGTGGGTGTCCATGCGGCCGGG - Intronic
1168954409 20:1824803-1824825 CTGTGGTCAGCCATGGGGTCTGG + Intergenic
1168957783 20:1846591-1846613 CAGTGAGGTGCCATGGGGACCGG + Intergenic
1169022258 20:2339217-2339239 GTGTGAGCAGCTGTGGGGCCTGG + Intronic
1170040031 20:12030296-12030318 GTGTCAGAAGCCATGTGGCCAGG + Intergenic
1171251789 20:23654438-23654460 CTGTGTGGAGATATGGGGCCAGG + Intergenic
1171307380 20:24117939-24117961 CTGGGAGGAGGAATGGGGCCAGG - Intergenic
1172488773 20:35317231-35317253 CTGTGTGTAGGAAAGGGGCCGGG - Intronic
1173276281 20:41586451-41586473 CTGTTAGAAGCCATGGGTCACGG - Intronic
1175915089 20:62422528-62422550 CCGAGAGAGGCCATGGGGCCTGG + Intronic
1177773588 21:25544263-25544285 ATGAGAGTAGCCATGGGTGCTGG - Intergenic
1178165295 21:29967749-29967771 GTGTGTGTAGGCATGGGGCAGGG + Intergenic
1179411234 21:41165263-41165285 ATGTGAGGAGGCTTGGGGCCAGG + Intergenic
1180167690 21:46038503-46038525 CTGGGTGCAGCCGTGGGGCCTGG - Intergenic
1181107717 22:20584764-20584786 CTGTGAGTGACCATGGGCCTGGG + Intronic
1181507427 22:23369357-23369379 CTGTGAGTGGGCCTGGGGCTTGG - Intergenic
1183662930 22:39231965-39231987 CTGTCATTAGCCATGGGACTTGG + Intronic
1183710703 22:39501822-39501844 TTGCCAGAAGCCATGGGGCCTGG + Intronic
1184415437 22:44349399-44349421 CTCTGTGCAGCCATGGGGCAGGG - Intergenic
1184897283 22:47417883-47417905 CTTAGTGGAGCCATGGGGCCAGG + Intergenic
1185243996 22:49763677-49763699 CTCTGTGCAGCCCTGGGGCCTGG + Intergenic
949535727 3:4995043-4995065 CTGTGAGAAGCCACGGGTCAGGG - Intergenic
949960408 3:9307347-9307369 CTGTGAACAGCCAGGGGTCCTGG + Intronic
950333666 3:12177048-12177070 CTGTGTGCAGCCATGGGACCTGG + Intronic
952055104 3:29434761-29434783 CTGGGAGGAGCCATGGGGTGGGG - Exonic
953470590 3:43162843-43162865 CCTTGAGTAGCCCTGGGACCTGG - Intergenic
954115530 3:48465109-48465131 CTGGAAGAAGCCATGGGGGCTGG - Intronic
956122378 3:65979100-65979122 CTGTGAGTAGCTGTGGGGGGTGG - Intronic
957930882 3:86876622-86876644 CTGTCAGGAGACATGGGGTCAGG + Intergenic
959291953 3:104485626-104485648 CTGTCAGGAGGCATGGGGTCAGG - Intergenic
959507893 3:107176078-107176100 CTGTGTGTAGCCTTGGGACTTGG + Intergenic
960547280 3:118930220-118930242 CTGGGAGTATCCAGGTGGCCCGG - Exonic
962089632 3:132229837-132229859 CTGTCAGCTGCCATGGGGCCAGG + Intronic
962417606 3:135197426-135197448 CTGTGAGTCACCCTGTGGCCTGG + Intronic
963607905 3:147428007-147428029 CTCTGACCAGCCCTGGGGCCCGG - Intronic
967281281 3:187826553-187826575 CTGTAAGCAGCCAGAGGGCCAGG - Intergenic
967478757 3:189950406-189950428 CTGTGCTTAGCCCTGCGGCCTGG + Intergenic
967983411 3:195078717-195078739 CTGTGTGCAGCCCTGGGGACTGG - Intronic
968591108 4:1460089-1460111 CTCTGAGTGGCCCTGGGGCTGGG + Intergenic
968767145 4:2478505-2478527 CTGTGTGCAGCCTAGGGGCCTGG + Intronic
968897681 4:3414240-3414262 CTGTGAGTAGGGAAGGGCCCAGG + Exonic
969355268 4:6621301-6621323 CTGGGGGAAGCCCTGGGGCCGGG - Exonic
969509943 4:7612080-7612102 GTGGGAGGAGTCATGGGGCCTGG + Intronic
970431100 4:15989944-15989966 CTGTGAGTGGGCATGGGGGCTGG + Intronic
972775059 4:42232657-42232679 CTGTGAGTAGCGAAGGGAGCCGG + Intergenic
976928914 4:90538189-90538211 CTGTGAGTAGGGATGGGGCTGGG + Intronic
977874187 4:102129672-102129694 ATGAGAGTAGCCATGGGGCCTGG + Intergenic
980104901 4:128578325-128578347 CTGTGGGTAGCTAGGGGGCATGG - Intergenic
982206732 4:153002126-153002148 CAGGGAGAAGGCATGGGGCCAGG - Intergenic
982652607 4:158105398-158105420 CTGGAAATAGCCATGGGGCTTGG + Intergenic
984142475 4:176020653-176020675 GTGTGTGTGGCCATGGAGCCAGG + Intergenic
986733001 5:10649141-10649163 CTGTTAGGAGGCTTGGGGCCAGG + Intronic
986784858 5:11104938-11104960 CTGTGGGGGGCCACGGGGCCCGG + Intronic
987016692 5:13827429-13827451 CTGTGTGTAGGCATGGGACTTGG + Intronic
987891048 5:23879205-23879227 ATGGGAGCAGCCATGGGGTCTGG + Intergenic
990042375 5:51389931-51389953 CTGTGAGTGGCTCTGGGGCCGGG + Exonic
990954394 5:61329275-61329297 CTGTGAGCAGCCAGAGGGGCTGG + Intergenic
992747090 5:79830509-79830531 CTGTGAGGATCTATGGGGCATGG - Intergenic
997606356 5:135178008-135178030 GTGTGTGTCCCCATGGGGCCTGG + Intronic
1002796332 6:473944-473966 CTGAGAGCAGCCCTGGGGCACGG - Intergenic
1004015997 6:11732468-11732490 CTGTGAGGAGCCAGGGGCCCTGG + Intronic
1005376456 6:25187362-25187384 CTTTGAGTAGCAGAGGGGCCAGG - Intergenic
1006344130 6:33466302-33466324 CTGTGTGCAGCCTAGGGGCCTGG + Intergenic
1007425411 6:41743250-41743272 CTGTGAGTGGGCATGGGGAGTGG - Exonic
1013409770 6:109873445-109873467 GTGAGAGTGGGCATGGGGCCGGG + Intergenic
1015951449 6:138557615-138557637 CTGTGACTAGTCATTGGACCTGG - Intronic
1020233742 7:6339806-6339828 CTGTGAGCATCCAGGGGACCGGG - Intronic
1021827648 7:24571640-24571662 CTGTGAGAAGCAAGTGGGCCTGG + Intergenic
1023887381 7:44368725-44368747 CTCAGAGTGGCCATGGGGCTGGG - Intergenic
1025095332 7:56091834-56091856 GTGTGAGCAGCCCAGGGGCCTGG - Intronic
1028113321 7:86968856-86968878 CTTTGAGTTGGCATGGGCCCAGG - Intronic
1029482921 7:100823829-100823851 CTGTGCGAAGCCAGTGGGCCTGG + Exonic
1029664126 7:101983449-101983471 CAGTCAGTGGCCATGGGCCCAGG - Intronic
1032217696 7:129970302-129970324 TTGTGAGTAACCAAGAGGCCAGG - Intergenic
1032357400 7:131223525-131223547 CTCTGTGTAGCAATGAGGCCTGG - Intronic
1033070105 7:138194262-138194284 CTGTGTGTGGCCATGCTGCCTGG - Intergenic
1033966660 7:146983512-146983534 TTGTGTGTAGCGATGGGGCAAGG - Intronic
1034720320 7:153286142-153286164 CTGTGAGTAGACAAGTGGACAGG + Intergenic
1035223689 7:157421929-157421951 CTGAGAACAACCATGGGGCCGGG - Intergenic
1035261193 7:157662631-157662653 GTGTGAGCAGGCATGGGGCCTGG + Intronic
1035385776 7:158471840-158471862 CTGAGAGGGGCCCTGGGGCCGGG - Intronic
1038006454 8:23434564-23434586 CTGTGGGCAGCCTTGGGGCAGGG + Intronic
1038754600 8:30329025-30329047 CTGTGAGTAGCTGTGGGCCAGGG - Intergenic
1043952263 8:86322407-86322429 CTGTGACTAGCCATTGGGGCTGG + Intergenic
1044751284 8:95418546-95418568 TTGTGGGTAGGCATTGGGCCAGG - Intergenic
1045702775 8:104886000-104886022 CTGAGAGGAGCAATGGGGACAGG + Intronic
1048391776 8:133973886-133973908 CTGTGAGCAGCCAAGGCTCCTGG - Intergenic
1049994233 9:1019371-1019393 CTGTGAGTATCCTAGGGGCCTGG + Intergenic
1050680678 9:8107676-8107698 CTGTGAGCAGCCAGGTGGCAGGG + Intergenic
1051358537 9:16261888-16261910 CTGTGGGTTGCCATGGGGACTGG - Intronic
1051448799 9:17171898-17171920 ATTAGAGTAGCCATGGAGCCAGG + Intronic
1053231119 9:36410502-36410524 CTGTGAGAAGCCATGCCACCAGG + Intronic
1057347129 9:94260515-94260537 GGGTCAGTAGCCTTGGGGCCTGG + Intronic
1057851939 9:98572694-98572716 CTGGGAGTAGCCTGGGAGCCTGG - Intronic
1060015292 9:120081344-120081366 CTCTGAGGATCCATGTGGCCAGG + Intergenic
1061553344 9:131350454-131350476 CTCTGTGTAGCCATGAGGCCCGG + Intergenic
1062117891 9:134818890-134818912 ATGTGACTCACCATGGGGCCGGG - Exonic
1062275030 9:135726435-135726457 CTGTGGCTCGCCATGTGGCCAGG + Intronic
1062412022 9:136430450-136430472 TTGTGAGGAGCCGTGGGGCGTGG + Intronic
1062432665 9:136532959-136532981 CTGTCGGCAGCCCTGGGGCCAGG - Intronic
1185560943 X:1060268-1060290 CTGTTAGAAGCCATGGGTCACGG - Intergenic
1187279690 X:17848596-17848618 GTGTGAGTGGCCAGGAGGCCAGG - Intronic
1187308118 X:18115492-18115514 CTTTGAGCACTCATGGGGCCTGG - Intergenic
1188582313 X:31728987-31729009 CAGTGAGTTTCCATGGGGTCAGG - Intronic
1191669517 X:63736059-63736081 CAGTGAGCAGCCATTGGGTCAGG + Intronic
1193624457 X:83799581-83799603 CTGTGAGAAGTCAGGGGGCATGG + Intergenic
1196546973 X:116974416-116974438 CTGTGTGTAGCCTTGGGACTTGG + Intergenic