ID: 1076701431

View in Genome Browser
Species Human (GRCh38)
Location 10:132275242-132275264
Sequence GCTGTCTGTGAGTAGCCATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 159}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701431_1076701447 9 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701431_1076701439 -2 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701431_1076701441 -1 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701431_1076701448 10 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701431_1076701451 20 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701431_1076701445 3 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701431_1076701450 19 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701431_1076701436 -7 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701431_1076701438 -3 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701431_1076701449 18 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701431_1076701437 -4 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701431_1076701452 27 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701431_1076701444 2 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701431 Original CRISPR GCTGTCTGTGAGTAGCCATG GGG (reversed) Intronic
902687934 1:18091044-18091066 GCTGCCTGTGAGAAGGGATGGGG + Intergenic
904494512 1:30879084-30879106 GCTGGCTGTGGGGAGCCCTGGGG + Intronic
907138780 1:52164909-52164931 GGTGTCTGTCAGAAGCTATGGGG + Intronic
907499777 1:54870423-54870445 GTTGTCTCTCAGTATCCATGGGG + Intronic
907745112 1:57205379-57205401 ACTCTCTGAGCGTAGCCATGGGG + Intronic
914654524 1:149726867-149726889 GCAGTCAGTGAGTAGCCACATGG - Intergenic
915853188 1:159350429-159350451 GCTGTCTCTCAGTATCCATGAGG + Intergenic
917431646 1:174975521-174975543 GCCCTGTGTGAGTGGCCATGTGG + Intronic
917923158 1:179767493-179767515 GTTGGCTGAGAGCAGCCATGCGG - Intronic
918579210 1:186105715-186105737 GATGTCTGTGGGTAGCCAGAAGG + Intronic
919451880 1:197782183-197782205 GCTGTGTTTGTGTAACCATGTGG + Intergenic
919955240 1:202408125-202408147 GCTGTCCCTCAGTATCCATGGGG - Intronic
922194597 1:223349040-223349062 GCTGTCTGCCAGGAGGCATGAGG + Intronic
923377805 1:233382469-233382491 GCTGTCTGTGGGTAAGCCTGAGG - Exonic
924422300 1:243920974-243920996 GCTGTCTGTGATTAGTAATCAGG + Intergenic
1063171929 10:3517013-3517035 GCAGTCTGTGAGCAGCCACGTGG + Intergenic
1063299550 10:4839620-4839642 GCTGTCACCGAGTAGCCATGGGG - Intronic
1064345140 10:14525662-14525684 GATGTCTGTCAGTAGGGATGTGG - Intronic
1064970418 10:21060493-21060515 GATGTCTTTGAGTAGGCAAGAGG - Intronic
1070607353 10:77908270-77908292 GCTGTCTGTGAGTTGCTAGGAGG - Intronic
1070608881 10:77919714-77919736 GCTGGCTGCCAGGAGCCATGTGG - Intronic
1071412272 10:85408352-85408374 GCTGACTGTGAGTCTCAATGGGG + Intergenic
1072821477 10:98562357-98562379 GCTGTCTGTGAGGATCCAACAGG - Intronic
1074439350 10:113461377-113461399 GCAGACTGTGAGGAGCCCTGAGG + Intergenic
1076014710 10:127018479-127018501 GCTGTCTGTGAGTCACCCTAGGG + Intronic
1076145611 10:128117437-128117459 GCTGTCTCTGGGGAGCCAGGTGG - Intronic
1076231366 10:128822513-128822535 GCTCTCTGTGAGAGGACATGGGG - Intergenic
1076701431 10:132275242-132275264 GCTGTCTGTGAGTAGCCATGGGG - Intronic
1079378632 11:19917176-19917198 GATTTCTGTGAGTTCCCATGAGG + Intronic
1080649752 11:34212650-34212672 GCTGTCTCTGAGTTTGCATGGGG - Intronic
1084960288 11:72712932-72712954 GCTGTATGTGGGTGGGCATGTGG - Intronic
1084992473 11:72940466-72940488 TCTGTCTGGCAGTAGCCATCAGG + Intronic
1098070964 12:66674251-66674273 TCTGTCTGTGTCTAGCCTTGTGG - Intronic
1100687548 12:97003477-97003499 TTTGTCTGTGAGTTGCAATGAGG - Intergenic
1100926352 12:99552673-99552695 GCTGTCCCTCAGTATCCATGGGG + Intronic
1102519492 12:113469809-113469831 GCTGGCTGAGCCTAGCCATGAGG + Intronic
1105235705 13:18550934-18550956 GCTGACTGTTATTAGCCATTAGG - Intergenic
1107490894 13:40879060-40879082 GATGTTTGTGAGTAGAGATGTGG - Intergenic
1109268204 13:60224902-60224924 GGTGTCTATGAGTGGCCAAGAGG - Intergenic
1109290290 13:60465875-60465897 GCTGTATGTGAGAAGAGATGGGG + Intronic
1111887082 13:94035495-94035517 GCTATTTGTGAATAGCTATGTGG - Intronic
1113597897 13:111547489-111547511 GGTGTCTGTGGGGAGCCGTGTGG - Intergenic
1116920483 14:50567136-50567158 GGTGGCTGCTAGTAGCCATGAGG - Intronic
1117239181 14:53811334-53811356 CCTGTCTCTTAGGAGCCATGTGG + Intergenic
1118359650 14:65045204-65045226 GGTGTCTCTGAGTAGACCTGTGG + Intronic
1119212195 14:72840435-72840457 AGGGGCTGTGAGTAGCCATGTGG - Intronic
1122201737 14:100126859-100126881 GCGCTCTGTGAGCAGCTATGGGG + Intronic
1122901689 14:104784681-104784703 GCTGCCTGTGACTGTCCATGTGG - Intronic
1124349572 15:28945112-28945134 GCTGGCTGTGAGTTGCCAGGTGG - Intronic
1124719129 15:32097005-32097027 CGTGTGTGTGAGTAGCCACGTGG + Intronic
1125678342 15:41514276-41514298 GGTTTCTGGGAGTAGCAATGAGG - Intergenic
1125786503 15:42322967-42322989 GCTGTCTGTGAAAAGCCTGGTGG - Intronic
1125794302 15:42393065-42393087 GTTGTCTCTGGGTAGCCACGGGG + Intronic
1126220872 15:46211285-46211307 GCTGACTTTGATTAGCCAAGAGG - Intergenic
1133989279 16:10692138-10692160 GCTTTCTCTGATCAGCCATGTGG - Intronic
1136248157 16:28986708-28986730 GCTACCTGTGAGTGGCCAGGTGG + Exonic
1137064274 16:35822860-35822882 CCTGTCTGTGATTAGACATCTGG - Intergenic
1138527025 16:57614733-57614755 GCTGACTCTGAGGAGGCATGGGG + Intronic
1140600586 16:76470823-76470845 AGTGTGTGTGAATAGCCATGTGG - Intronic
1141253834 16:82382738-82382760 GCTGTTTCTGAGTAACAATGGGG + Intergenic
1142053748 16:87978598-87978620 CCTGCCTGTGAGGAGTCATGAGG + Intronic
1142537386 17:628281-628303 AGTGGCTGTGAGAAGCCATGAGG - Intronic
1147733391 17:42618298-42618320 GCTGTATGTGAGTGGCCAGCTGG + Intergenic
1147914905 17:43880358-43880380 GCTGCATGTGTGTAGCCTTGTGG - Intronic
1148211591 17:45811982-45812004 GCTGTCTCTTGGTATCCATGGGG + Intronic
1153742307 18:8141268-8141290 GCTGCCTGGGAGTGGCCATCCGG - Intronic
1154513834 18:15139065-15139087 GCTGACTGTTATTAGCCATTAGG + Intergenic
1156345028 18:36249324-36249346 GTTTTCTGTGGGTAGTCATGTGG - Intronic
1162015343 19:7843612-7843634 GGTGTGTGTGAATAGGCATGAGG + Intronic
1162974822 19:14202759-14202781 GCTGTCTGTGTGCACACATGGGG - Intronic
1165722350 19:38088570-38088592 GGTGTCTGTGACCAGGCATGAGG + Intronic
926396250 2:12445725-12445747 CCTGTCTGTGTGGAGCCAGGGGG + Intergenic
927371562 2:22361485-22361507 TGTGCCTGTGTGTAGCCATGGGG - Intergenic
927430558 2:23023265-23023287 GCTGTGTTGGAGTGGCCATGGGG - Intergenic
937447495 2:121971219-121971241 GCTGAGGGTGAGTAGCCAGGAGG - Intergenic
937669098 2:124519541-124519563 TCTGCCTCTGAGCAGCCATGGGG + Intronic
938514078 2:131983678-131983700 GCTGACTGTTATTAGCCATTAGG + Intergenic
939106049 2:137950069-137950091 GCGGTCTCTCAGGAGCCATGTGG - Intergenic
939954727 2:148518217-148518239 ACAGTCTGTGCGTAGCCGTGGGG + Intronic
943488827 2:188523310-188523332 AATGTCCGTAAGTAGCCATGGGG + Intronic
946187892 2:217991448-217991470 ACTGACTGGGAGGAGCCATGAGG - Intronic
946759301 2:222977359-222977381 TCCAACTGTGAGTAGCCATGGGG + Intergenic
948639980 2:239369379-239369401 GCTGTCTCTGGGGAGCCCTGTGG - Intronic
1168898223 20:1338440-1338462 GCTGCCTGTGGGTGGCTATGTGG + Intronic
1170634190 20:18090725-18090747 TCTGTCTGGCAGTAGCCATCAGG - Intergenic
1171404341 20:24899967-24899989 GCTGCCTGTGAGAAGCCACTGGG - Intergenic
1173945765 20:46949775-46949797 TCTGTCTGTGTGTAGCCCAGAGG + Intronic
1175062070 20:56252534-56252556 AAAGTCTGTGAGTAGCCCTGGGG + Intergenic
1176779706 21:13179219-13179241 GCTGACTGTTATTAGCCATTAGG - Intergenic
1177696481 21:24579675-24579697 GCTGTATGTCAGGAGCCGTGTGG - Intergenic
1177977347 21:27868259-27868281 GCTGACTGTTATTAGCCATTAGG - Intergenic
1179064908 21:38015794-38015816 GGTGTCTTTGAGAAACCATGAGG - Intronic
1180839382 22:18952021-18952043 ACTGGCTGTGAGTAGCTCTGTGG - Intergenic
1181671330 22:24426881-24426903 TGTTTCTGTGAGTTGCCATGGGG + Intronic
1182214145 22:28701824-28701846 GCTGTCCCTCAGTATCCATGGGG + Intronic
949961790 3:9318344-9318366 GCTTTCTGTGTGGAGCCCTGTGG - Intronic
953474253 3:43192681-43192703 GCTCTCTGTGACTAATCATGTGG - Intergenic
962452009 3:135527708-135527730 GCAGTTTGTGAGTAGCAATGTGG + Intergenic
963986282 3:151598448-151598470 GTCATCTGTGAGTATCCATGGGG + Intergenic
967953270 3:194857233-194857255 GGTGGCTGTGAACAGCCATGCGG - Intergenic
968289345 3:197526611-197526633 GCTGGCTGGGAGGATCCATGTGG - Intronic
968558443 4:1262448-1262470 GCTGTCTCTCAGTATCCATGCGG + Intergenic
968769729 4:2496991-2497013 GCTTTCTCTGAGTAGCAAGGGGG - Exonic
969058939 4:4419982-4420004 GCAGTCTGTGAGTGCCCATGAGG + Exonic
970321010 4:14875384-14875406 GCTGCCAGGGAGTGGCCATGGGG + Intergenic
970431098 4:15989939-15989961 GATGGCTGTGAGTGGGCATGGGG + Intronic
971686820 4:29781060-29781082 GCTGTCTCTCAGTATCCATGGGG - Intergenic
972214473 4:36879792-36879814 GCTGTCTGAGAGTAGAGATGAGG - Intergenic
976086091 4:81408631-81408653 GCTGAGAGTGAGTAGCAATGAGG + Intergenic
976117886 4:81747728-81747750 GCTGGCTGTGAGTAGTCTGGGGG - Intronic
977590660 4:98822905-98822927 GCTCTCTGTGAGCTGCTATGAGG + Intergenic
978321064 4:107496485-107496507 CCTGTCTGGGTGGAGCCATGGGG + Intergenic
979550738 4:121988330-121988352 GGAATCTGTGAGTATCCATGTGG + Intergenic
983525122 4:168753134-168753156 GCTGCTTGTGAGTAGTCAGGTGG - Intronic
988461189 5:31439337-31439359 GCTGTCACTTAGTAGCCATGTGG + Intronic
988537238 5:32079858-32079880 TTTTTCTGTGAGTAGCCATCAGG - Intronic
989400300 5:41001081-41001103 TCTGTCTTTGAGTAGCCAGTGGG + Intronic
990181742 5:53168214-53168236 GATTTCTGTGAGTAGGCCTGTGG + Intergenic
990562952 5:57002046-57002068 GCTATCTGTAAGTGACCATGTGG + Intergenic
994146310 5:96399805-96399827 GTTCTCTGTGGGTATCCATGGGG - Intronic
994440152 5:99791701-99791723 GCTGTATCTGAGTAGCCACCAGG - Intergenic
994791337 5:104230217-104230239 GCTGTCTCTCAGTAGCACTGTGG - Intergenic
995246732 5:109943890-109943912 GCTGGCAGTGACTAGACATGAGG + Intergenic
998036349 5:138920320-138920342 GCTGTGTGTCAGGAGCGATGGGG - Intronic
1001560008 5:172662918-172662940 GCAGCCTGTGATTAACCATGGGG + Intronic
1004408621 6:15359599-15359621 GCTATCTGTGGGTAGCGGTGGGG + Intronic
1007023298 6:38544316-38544338 GTTGTCTCTCAGTATCCATGGGG - Intronic
1007375605 6:41454446-41454468 TCTGTGTGTGTGTATCCATGAGG + Intergenic
1007425412 6:41743255-41743277 CCTGACTGTGAGTGGGCATGGGG - Exonic
1010991069 6:82480494-82480516 GCTATTTGAGAGTAGACATGGGG - Intergenic
1013042199 6:106446816-106446838 TTTGTCTGAGAATAGCCATGCGG + Intergenic
1013429419 6:110042590-110042612 GCAGTCTGTGAGTAGCAAGAAGG - Intergenic
1015483607 6:133743353-133743375 GTTGTCCGTCAGTATCCATGGGG - Intergenic
1016990371 6:149924314-149924336 GCTGGCAGTTAGTAGCTATGGGG - Intergenic
1017143518 6:151213364-151213386 GCTTACTGTGAGAAGCCATGTGG + Intergenic
1018656787 6:166044677-166044699 GGTTTCTGTGAGTAGCCACTAGG - Intergenic
1018960503 6:168444172-168444194 ACTTTGTGGGAGTAGCCATGTGG + Intronic
1019093073 6:169556120-169556142 GCTGGCTGTGAGGAGGCATGTGG + Intronic
1019675254 7:2307752-2307774 TGTGTCTGAGAGGAGCCATGCGG - Intronic
1020800419 7:12725982-12726004 GCTGTGTGGGAGTAGCTATGGGG - Intergenic
1021167369 7:17358135-17358157 GCTGTCTTTGTGTTGCCTTGTGG - Intergenic
1021965870 7:25917304-25917326 GATGGCTGTAAGCAGCCATGGGG - Intergenic
1022302353 7:29113410-29113432 GCTCCCCCTGAGTAGCCATGAGG - Intronic
1022392866 7:29958732-29958754 GCTGGGTGGGAGTGGCCATGGGG - Intronic
1023605846 7:41929934-41929956 GTTGTCTGGGAGTAGCAATCTGG + Intergenic
1023669994 7:42565727-42565749 GCTGTATGTGAATGGCCAAGAGG - Intergenic
1023701051 7:42892220-42892242 GCAGTCTGTGAGTATCACTGGGG - Intergenic
1023726426 7:43146806-43146828 GCTGTCTGTGCACAGACATGGGG - Intronic
1026020471 7:66701090-66701112 ACTGTTTGTGAGCAGCCGTGTGG + Intronic
1026879810 7:73901269-73901291 ACTGTCTGTGAGCAGCTGTGTGG - Intergenic
1027185411 7:75968065-75968087 GCTGAGAGTGAGAAGCCATGGGG + Intronic
1032818263 7:135499434-135499456 GTTTTCTGTGAGTGGCCTTGGGG - Intronic
1034620899 7:152456369-152456391 GCTGTCTGGGCGTAGCCCTCAGG - Intergenic
1034720318 7:153286137-153286159 GCCTTCTGTGAGTAGACAAGTGG + Intergenic
1035176420 7:157055210-157055232 GCTGTCTCTTACCAGCCATGTGG + Intergenic
1036192746 8:6685782-6685804 GATGTCTGTGTGAAGCCAGGTGG + Intergenic
1036529969 8:9576084-9576106 TCTGTCAGTGACTGGCCATGAGG - Intronic
1041172183 8:55155212-55155234 GCTGTCTGGGAGCAGCAATGTGG - Intronic
1041643271 8:60225773-60225795 GCTGAATGTGAGTGGCCTTGGGG - Intronic
1042647491 8:71003902-71003924 GCTCTCTCTGAGTTCCCATGAGG - Intergenic
1043656197 8:82670205-82670227 GTTGTCTCTCAGTATCCATGGGG - Intergenic
1045314036 8:101027818-101027840 GCTGCCTCTAAGTAGTCATGTGG + Intergenic
1046756319 8:117976469-117976491 TATGTCTGTGAGGATCCATGAGG - Intronic
1049576171 8:143390891-143390913 ACTGTCGGTGAGTGGCCGTGGGG + Intergenic
1052188967 9:25634183-25634205 GTTATCTGTGAGTAGACATGGGG - Intergenic
1057847320 9:98535658-98535680 GCTGTCCCTTAGTAACCATGGGG - Intronic
1058179903 9:101784655-101784677 CCTTTCTGTGAACAGCCATGAGG - Intergenic
1059820243 9:117964667-117964689 GATTTCTGTGACTAGCCTTGTGG + Intergenic
1061859345 9:133460181-133460203 GCAGTCTGTGAGTATCCAGTCGG + Exonic
1186405474 X:9298230-9298252 GCTGGCTCTGAGTAGACATGTGG + Intergenic
1197655278 X:129110243-129110265 GGTGTGTGTGTGTAGCCATTTGG - Intergenic
1197725376 X:129772997-129773019 CCTGGCTGTGACGAGCCATGAGG - Intergenic
1198706236 X:139451498-139451520 GATGTCTTTGAGTAGGCAAGAGG + Intergenic
1199295257 X:146150044-146150066 TCTGTCTCTGAATGGCCATGTGG + Intergenic
1200215879 X:154368086-154368108 GCTGTCTGTGAGTAGAAGAGTGG + Exonic
1200777717 Y:7184381-7184403 GCTGTCTCTCATTAGCCATAGGG + Intergenic
1201503732 Y:14674651-14674673 GCTGTCAGTCAGTCGCCCTGTGG + Intronic