ID: 1076701432

View in Genome Browser
Species Human (GRCh38)
Location 10:132275243-132275265
Sequence GGCTGTCTGTGAGTAGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701432_1076701452 26 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701432_1076701439 -3 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701432_1076701437 -5 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701432_1076701447 8 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701432_1076701445 2 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701432_1076701448 9 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701432_1076701441 -2 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701432_1076701438 -4 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701432_1076701444 1 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701432_1076701449 17 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701432_1076701451 19 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701432_1076701450 18 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701432_1076701436 -8 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701432 Original CRISPR GGCTGTCTGTGAGTAGCCAT GGG (reversed) Intronic
902687933 1:18091043-18091065 GGCTGCCTGTGAGAAGGGATGGG + Intergenic
904494511 1:30879083-30879105 GGCTGGCTGTGGGGAGCCCTGGG + Intronic
913657243 1:120972951-120972973 TTCTGTGTGTGAGTAGCAATGGG + Intergenic
914008585 1:143756036-143756058 TTCTGTGTGTGAGTAGCAATGGG + Intergenic
914521798 1:148424230-148424252 TTCTGTGTGTGAGTAGCTATGGG + Intergenic
914647216 1:149664687-149664709 TTCTGTGTGTGAGTAGCAATGGG + Intergenic
918448394 1:184636177-184636199 GGCTTTCTGAGAGTAGCCCCAGG + Intergenic
920607154 1:207399728-207399750 GGCTGTCTGTCAATAGCTGTAGG + Intergenic
920872631 1:209806565-209806587 TCCTGTCTGGGAGAAGCCATAGG + Intergenic
922630817 1:227108602-227108624 GGTTGTCTCTCAGTATCCATAGG + Intronic
923051520 1:230394058-230394080 GGCGTTCTCTGAGGAGCCATAGG - Intronic
1063127265 10:3146541-3146563 GGCGGTCTGTGGGTGGCCAGAGG - Intronic
1063299551 10:4839621-4839643 GGCTGTCACCGAGTAGCCATGGG - Intronic
1063778379 10:9291311-9291333 AGCTGTCTGTGACTAACCAAAGG - Intergenic
1065487672 10:26250395-26250417 GGGTGTATGTGAGTAGACAGGGG - Intronic
1065662469 10:28020083-28020105 GCCTCTCTGTGAGTCCCCATAGG - Intergenic
1069305954 10:66970104-66970126 GGCTGTCCATGAGTGGCCCTGGG - Intronic
1071412271 10:85408351-85408373 GGCTGACTGTGAGTCTCAATGGG + Intergenic
1075016803 10:118915668-118915690 GGCTGTCTGGGACCAGCAATGGG + Intergenic
1075380324 10:122013539-122013561 GGCTATCTGTGAATAGCAATGGG + Intronic
1076014709 10:127018478-127018500 AGCTGTCTGTGAGTCACCCTAGG + Intronic
1076701432 10:132275243-132275265 GGCTGTCTGTGAGTAGCCATGGG - Intronic
1076837937 10:133030420-133030442 GTCTGTCTGTGAAGAGCCCTTGG - Intergenic
1077187979 11:1243927-1243949 GGCCGTCTGTGAGCAGCCCCTGG + Exonic
1077188405 11:1245598-1245620 GGCCGTCTGTGAGCAGCCCCTGG + Exonic
1077188936 11:1247698-1247720 GGCAGTCTGTGAGCAGCCCCTGG + Exonic
1077189361 11:1249369-1249391 GGCCGTCTGTGAGCAGCCCCTGG + Exonic
1078431193 11:11290042-11290064 GGCTGTCTTGGAGTAGCCCCTGG - Intronic
1078713319 11:13816061-13816083 GGCTGTTTGTCAGTAGTGATGGG + Intergenic
1079226906 11:18614795-18614817 GGCGGTCTGTCAGTGGCCCTGGG - Exonic
1083591650 11:63898905-63898927 GCCTGTCTGTAAGTGGCCCTTGG + Intronic
1084219320 11:67667736-67667758 GGGTGTCTGTGAGCCCCCATGGG - Intronic
1091306818 11:134541607-134541629 GGCTGGGTGACAGTAGCCATGGG + Intergenic
1097156460 12:57015716-57015738 GGCTGTCTGTAAGGAGCCACAGG - Exonic
1100926351 12:99552672-99552694 GGCTGTCCCTCAGTATCCATGGG + Intronic
1101347829 12:103902901-103902923 GGGTGTCTGTGAGTAAACAGAGG - Intergenic
1105826842 13:24130245-24130267 GGCCGTGTGTGTGAAGCCATGGG - Intronic
1106489717 13:30208998-30209020 GGCTGTCTTTGAGGAGCAAGTGG - Intronic
1111548807 13:89780960-89780982 GTCTGTCTATGATAAGCCATTGG + Intergenic
1112467963 13:99660618-99660640 GGCTGTTTGTTGGTGGCCATTGG - Intronic
1117538834 14:56727173-56727195 GGCTGTCAGTGAATATGCATTGG - Intronic
1117969958 14:61241737-61241759 GGCTGACTCTGTGTGGCCATGGG + Intronic
1118690333 14:68332665-68332687 GGCTGTCTCTAGTTAGCCATAGG + Intronic
1119544901 14:75464619-75464641 AGTTGTCTCTCAGTAGCCATGGG - Intronic
1122201736 14:100126858-100126880 GGCGCTCTGTGAGCAGCTATGGG + Intronic
1125610948 15:40969801-40969823 GGCCCTCTCTGAGTAGCCAGAGG - Intergenic
1129609194 15:77039404-77039426 TGCTGTCTTTGAGTGGCCCTCGG - Intergenic
1134397424 16:13877895-13877917 GTGTGTGTGTGAGCAGCCATAGG - Intergenic
1135079927 16:19425355-19425377 GCCTGTCTGTGAGCAGTCAAGGG - Intronic
1137748909 16:50843711-50843733 GGGTGTCTGTCAGTAGCGAATGG - Intergenic
1138155886 16:54702494-54702516 GGCTGTAAATAAGTAGCCATTGG + Intergenic
1138776864 16:59733995-59734017 GGCTGTCAGTGAGGAGCAAAGGG - Intronic
1141515172 16:84539331-84539353 GGCTCACTGTGAGAAGCCTTAGG + Intronic
1144779678 17:17801520-17801542 TGCTGTCTGTGAGTGGCCCTTGG - Intronic
1148775815 17:50095257-50095279 AGTTGTTTGTGAGTGGCCATTGG + Exonic
1151314852 17:73315510-73315532 AGCTGTCTATGAGTAACCAGAGG + Intergenic
1157785513 18:50478472-50478494 GGGTGTCTGTCTTTAGCCATGGG - Intergenic
1161285444 19:3466067-3466089 GTCTGTCTGTCTGTACCCATGGG + Intronic
1163446349 19:17348774-17348796 GGCTGTCTGGCAGTAGGCTTAGG + Intergenic
1164456059 19:28408040-28408062 GGAAGTCAGTGAGTAGACATTGG - Intergenic
1164470136 19:28523143-28523165 GGCTGCTTGTCAGTAGCCAATGG - Intergenic
1164521240 19:28981933-28981955 GGCTGGCTGTGAGGAGCCTGTGG - Intergenic
1166835892 19:45667829-45667851 GGCTGTCTGGGTGTGACCATGGG + Intergenic
927088675 2:19694144-19694166 GGGTTTCTATGAGTATCCATTGG + Intergenic
928669679 2:33589094-33589116 GGCTCTCTTTGATTAGCCAGAGG - Intronic
929946192 2:46374341-46374363 GACTGTCTGTGACAGGCCATGGG + Intronic
930450254 2:51526927-51526949 AGCTGTCTGTGAAGAGACATAGG + Intergenic
932325743 2:70860478-70860500 GGCTGGCTGAGATGAGCCATGGG - Intergenic
933191566 2:79339449-79339471 GGCTGGATGTGAGTAGACTTTGG - Intronic
934716295 2:96546600-96546622 GGATGGCTGTGAGTAGCCTAGGG + Intronic
934996646 2:98967642-98967664 GGCTGTGTGTGAGTACCTAAAGG + Intergenic
936071864 2:109376405-109376427 GGCTCTGTGTGAGCAGCCAGAGG - Intronic
937341933 2:121096745-121096767 GGCTGGCTCTGAGTCTCCATTGG - Intergenic
937923056 2:127145945-127145967 GGCTGTCTTTGAGTTGCCCATGG - Intergenic
938933175 2:136104941-136104963 GGCTGTGTGTGAGCAGCCACAGG - Intergenic
939956507 2:148531893-148531915 GCCTGTCTGGGAGGAGCCAGTGG - Intergenic
940509399 2:154593493-154593515 GGCGGTCTGGGTGGAGCCATTGG - Intergenic
943070560 2:183136039-183136061 GGCAGTCTGTGAGCACTCATTGG + Intronic
947836543 2:233180018-233180040 GGCTGGCTGTCAGCAGGCATAGG + Intronic
1170379095 20:15736765-15736787 GGCTGACTTTAAGTAGCCATTGG + Intronic
1170717398 20:18843836-18843858 GGCGTTCTGTGTGGAGCCATTGG - Intergenic
1171152915 20:22843480-22843502 GGCTGTGTGTGAGCAGTCATTGG + Intergenic
1171404342 20:24899968-24899990 AGCTGCCTGTGAGAAGCCACTGG - Intergenic
1174173931 20:48633215-48633237 GGTTCTCTTTGAGTAGCAATTGG - Intronic
1174841391 20:53904712-53904734 GGTTGGCTGTGAGGAGCCAGGGG - Intergenic
1175775636 20:61651851-61651873 GGCTGTGGGTGGGAAGCCATCGG + Intronic
1177725345 21:24959748-24959770 GGCTTTTTGTGAGTGACCATGGG - Intergenic
1181511231 22:23389495-23389517 GGCTGTCTGTTAGCTGCCAGAGG - Intergenic
1181908689 22:26220532-26220554 GCCTGTCTGTCAGTTGCCTTGGG + Intronic
1181937416 22:26448890-26448912 GGCTCTCTGTGAGGAGACAGGGG - Intronic
949535729 3:4995049-4995071 GGCAGACTGTGAGAAGCCACGGG - Intergenic
953122396 3:40057570-40057592 GGTGGTCTGTGAGAAGCCACTGG - Intronic
953161800 3:40427532-40427554 GGCTGACTCTAAGCAGCCATTGG - Exonic
953243241 3:41167929-41167951 GGCTGTCTCTGTGTAGACAGTGG - Intergenic
966221259 3:177553409-177553431 GGCTGGCTGTTAGAAGCCTTAGG - Intergenic
966739699 3:183221218-183221240 GGGGGTCTGTGAGGAGCCGTGGG - Intronic
967325454 3:188234156-188234178 GACAGTCTGTGAATAGCCCTTGG - Intronic
968730935 4:2268879-2268901 GGGTGCCTGTGAGGAGCCAGGGG + Intergenic
971681265 4:29704021-29704043 GGCTGTCAGTTGGTAGTCATTGG - Intergenic
971686821 4:29781061-29781083 AGCTGTCTCTCAGTATCCATGGG - Intergenic
980830415 4:138124602-138124624 GGCAGTCTGTGAGTATCCCTTGG + Intergenic
983627075 4:169812702-169812724 GGCTCTCTGGAAGTAGGCATAGG + Intergenic
985801115 5:2005750-2005772 GGCTGTCTGGGAGCGGCCACGGG + Intergenic
989400299 5:41001080-41001102 TTCTGTCTTTGAGTAGCCAGTGG + Intronic
998036350 5:138920321-138920343 GGCTGTGTGTCAGGAGCGATGGG - Intronic
998082411 5:139287770-139287792 GCCTGTTTGTGAGCAGGCATGGG - Intronic
998557371 5:143138594-143138616 GTCTCTCTGTGAGTAGCAGTGGG + Intronic
1000182228 5:158822555-158822577 TGCTGTCTGTAAGTAGACTTTGG - Intronic
1001304937 5:170565262-170565284 CCTTGTCTGAGAGTAGCCATGGG + Intronic
1003114067 6:3271702-3271724 GGCTGTCTCTTAGTCGCCTTGGG + Exonic
1003327473 6:5103421-5103443 GGCTGTGTGTCAGTAGCCCAGGG - Intronic
1004408620 6:15359598-15359620 GGCTATCTGTGGGTAGCGGTGGG + Intronic
1012992545 6:105940509-105940531 GTCTGTCTGTGAGTAGAACTAGG - Intergenic
1013733009 6:113191383-113191405 GGATTTCTGTGAGTACCCAAGGG - Intergenic
1015616869 6:135086285-135086307 GTCTCTCTGTCAGCAGCCATGGG - Intronic
1015759734 6:136645382-136645404 GGCCTTCTGTGAGTGGCCACTGG + Intronic
1019100183 6:169623818-169623840 GGCTGGCACTGAGTAGCCGTTGG - Intronic
1020800420 7:12725983-12726005 AGCTGTGTGGGAGTAGCTATGGG - Intergenic
1022392867 7:29958733-29958755 GGCTGGGTGGGAGTGGCCATGGG - Intronic
1023358635 7:39393464-39393486 GGGTGTCTGTAAGCAGCCCTGGG - Intronic
1023477614 7:40598059-40598081 ACTTGTCTGTGAGAAGCCATGGG - Intronic
1023701052 7:42892221-42892243 GGCAGTCTGTGAGTATCACTGGG - Intergenic
1032818264 7:135499435-135499457 GGTTTTCTGTGAGTGGCCTTGGG - Intronic
1033350492 7:140558285-140558307 GGGTGGCAGTGAGCAGCCATGGG + Intronic
1034111325 7:148540565-148540587 GGCTGTGCGTGAGCAGCCAAAGG - Intergenic
1034533754 7:151714017-151714039 GACTGTCTGTGAGAATCCTTTGG - Intronic
1039786659 8:40840244-40840266 AGCTGTCAGTTAGTAGCCATGGG - Intronic
1042255346 8:66797148-66797170 GGCTGTATTTGGGTAGCCAGGGG + Intronic
1045463146 8:102444052-102444074 GGATGTCTCTGAGTTGCCACAGG - Intergenic
1049576170 8:143390890-143390912 GACTGTCGGTGAGTGGCCGTGGG + Intergenic
1051388857 9:16541415-16541437 GTCTGTCTTGCAGTAGCCATGGG - Intronic
1052188968 9:25634184-25634206 GGTTATCTGTGAGTAGACATGGG - Intergenic
1057310616 9:93940758-93940780 TGATGTCTGTGATTAGGCATGGG - Intergenic
1062578558 9:137219835-137219857 GGTTGTGTGGGAGTAGCCTTTGG - Intergenic
1186906091 X:14112200-14112222 GGCTGTCTCTGTTTAGCCAAAGG + Intergenic
1194842172 X:98756244-98756266 GGTTGTCTGTGGATAGCAATTGG + Intergenic
1198651065 X:138864452-138864474 GGCATTCTGTGAGTAGCCTCAGG + Intronic
1200777716 Y:7184380-7184402 GGCTGTCTCTCATTAGCCATAGG + Intergenic