ID: 1076701433

View in Genome Browser
Species Human (GRCh38)
Location 10:132275244-132275266
Sequence GGGCTGTCTGTGAGTAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701433_1076701452 25 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701433_1076701448 8 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701433_1076701437 -6 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701433_1076701441 -3 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701433_1076701444 0 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data
1076701433_1076701451 18 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701433_1076701439 -4 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701433_1076701447 7 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701433_1076701449 16 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701433_1076701445 1 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701433_1076701436 -9 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701433_1076701438 -5 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701433_1076701450 17 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC No data
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701433 Original CRISPR GGGCTGTCTGTGAGTAGCCA TGG (reversed) Intronic