ID: 1076701433

View in Genome Browser
Species Human (GRCh38)
Location 10:132275244-132275266
Sequence GGGCTGTCTGTGAGTAGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 163}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701433_1076701451 18 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701433_1076701449 16 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701433_1076701441 -3 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701441 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG No data
1076701433_1076701447 7 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701447 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
1076701433_1076701438 -5 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701438 10:132275262-132275284 AGCCCCACAGGGCCGCTGGTGGG No data
1076701433_1076701450 17 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701433_1076701436 -9 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701436 10:132275258-132275280 AGACAGCCCCACAGGGCCGCTGG No data
1076701433_1076701448 8 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701448 10:132275275-132275297 CGCTGGTGGGGGTGGGTGCTGGG No data
1076701433_1076701452 25 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701433_1076701445 1 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701445 10:132275268-132275290 ACAGGGCCGCTGGTGGGGGTGGG No data
1076701433_1076701437 -6 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701437 10:132275261-132275283 CAGCCCCACAGGGCCGCTGGTGG No data
1076701433_1076701439 -4 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701433_1076701444 0 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701444 10:132275267-132275289 CACAGGGCCGCTGGTGGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701433 Original CRISPR GGGCTGTCTGTGAGTAGCCA TGG (reversed) Intronic
904406623 1:30294696-30294718 GGGCTGTCTGCAAGGAGGCAGGG - Intergenic
904494510 1:30879082-30879104 GGGCTGGCTGTGGGGAGCCCTGG + Intronic
909079157 1:71088110-71088132 GGGATGTGTGTGAGTATTCATGG + Intergenic
912625370 1:111201590-111201612 GGGGTTTCTGTGAGAATCCAAGG - Intronic
913657242 1:120972950-120972972 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
914008584 1:143756035-143756057 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
914521797 1:148424229-148424251 GTTCTGTGTGTGAGTAGCTATGG + Intergenic
914647215 1:149664686-149664708 GTTCTGTGTGTGAGTAGCAATGG + Intergenic
916484157 1:165243331-165243353 GGCCTGGCTGTGGGTAACCATGG - Intronic
916853434 1:168726777-168726799 GGCCTGGCTGTGAGGAGTCATGG + Intronic
917342760 1:173996571-173996593 GGTTTATCTGTGAGTGGCCAGGG - Intronic
917480013 1:175403791-175403813 GGGCTGTCTGTGCCTAGCACAGG + Intronic
918116640 1:181503561-181503583 GGGCTGGCTGGCTGTAGCCATGG - Intronic
1063299552 10:4839622-4839644 TGGCTGTCACCGAGTAGCCATGG - Intronic
1063448296 10:6134148-6134170 GGGCTTTCTGAGAGTGGACAGGG + Intergenic
1065487673 10:26250396-26250418 GGGGTGTATGTGAGTAGACAGGG - Intronic
1070544155 10:77439626-77439648 GGGCTCTCTGAAAGTGGCCAGGG + Intronic
1070833365 10:79433557-79433579 GGGCTGGCAGGGAGCAGCCAGGG + Intronic
1070933882 10:80278851-80278873 GCGCTGTCTGCTAGTGGCCAGGG + Intronic
1074421041 10:113309193-113309215 GGGCTGCCTGGCAGGAGCCAAGG + Intergenic
1074501634 10:114030166-114030188 GGGGTGGCTGGGAGGAGCCATGG - Intergenic
1075380323 10:122013538-122013560 GGGCTATCTGTGAATAGCAATGG + Intronic
1076182075 10:128417743-128417765 GGGCTGGCTGTTAGCATCCAGGG + Intergenic
1076701433 10:132275244-132275266 GGGCTGTCTGTGAGTAGCCATGG - Intronic
1077332700 11:1990372-1990394 GGGGTGACTGTGGGGAGCCATGG - Intergenic
1078713318 11:13816060-13816082 GGGCTGTTTGTCAGTAGTGATGG + Intergenic
1079226907 11:18614796-18614818 GGGCGGTCTGTCAGTGGCCCTGG - Exonic
1083635655 11:64119557-64119579 GGGCTTTGTTTGAGCAGCCATGG - Intronic
1084219321 11:67667737-67667759 GGGGTGTCTGTGAGCCCCCATGG - Intronic
1084314553 11:68337564-68337586 GGGCTGACTGTGGGTAGACCTGG - Intronic
1084512821 11:69616703-69616725 GGGCTTTGTGTGTGTTGCCAGGG - Intergenic
1085198741 11:74688616-74688638 GGGGTGGCTGTGAGAACCCATGG - Intergenic
1087823030 11:102732664-102732686 AGGCTGTCTGTGAGTACCTCGGG - Intergenic
1089012618 11:115143281-115143303 GGGCTGTGTCTGGGCAGCCACGG - Intergenic
1090239693 11:125173377-125173399 GGTGTGTCTGTGTGTAGCAATGG + Intronic
1090425419 11:126603808-126603830 GGGATGTATGGGAGAAGCCAGGG + Intronic
1091306817 11:134541606-134541628 GGGCTGGGTGACAGTAGCCATGG + Intergenic
1202815683 11_KI270721v1_random:45548-45570 GGGGTGACTGTGGGGAGCCATGG - Intergenic
1096878140 12:54646238-54646260 GGGCTTTATGTGAGAAGGCAGGG + Intronic
1102330245 12:112022655-112022677 AGGCTGTCTGTGATTTTCCAGGG + Exonic
1102436123 12:112925332-112925354 CGCCTGTCTGTGAGGTGCCAGGG + Intronic
1102688628 12:114743312-114743334 AGGCTGTCTGTGGCTAGGCAGGG + Intergenic
1104313459 12:127675546-127675568 GGGCTGGCTGGGAGGAGCCTGGG - Intergenic
1107427076 13:40304860-40304882 GTGCTGTCTCTCAGTAGCTAAGG - Intergenic
1107718296 13:43222052-43222074 GAGCTATCTGGGAGTAGGCAGGG + Intronic
1108714754 13:53068171-53068193 GGGATGTCTGGCAGGAGCCATGG - Intergenic
1109298188 13:60561380-60561402 TGGTTGTCAGTGAGTAGCAAAGG + Intronic
1111347310 13:86975015-86975037 GGGCTGCCTGTGACCACCCAAGG + Intergenic
1112321926 13:98415730-98415752 AGTCTGTCAGTCAGTAGCCAGGG - Intronic
1114675340 14:24436501-24436523 GGGCTGCCTGTAAGTAGTCTAGG - Intronic
1115390224 14:32845973-32845995 GGGCTATCTGTGAGTAGAAATGG - Intergenic
1117366929 14:55038362-55038384 AAGCTGTGTGTGAGTAGCCAGGG + Intronic
1117787577 14:59303011-59303033 TGGCTGTGTGTCAGTTGCCAAGG + Intronic
1118947005 14:70398204-70398226 GGGCTGTCTGTGGCTGCCCATGG - Intronic
1122201735 14:100126857-100126879 GGGCGCTCTGTGAGCAGCTATGG + Intronic
1124372239 15:29110446-29110468 GGGCTGTCAGTGAGCAGCACTGG - Intronic
1125731372 15:41894360-41894382 GGCCTCTCTGTGAGCACCCAGGG + Intergenic
1125920668 15:43523693-43523715 GCTCAGTCTCTGAGTAGCCAGGG - Exonic
1129167819 15:73788731-73788753 GGGCTGTCCTTGACTGGCCAAGG - Intergenic
1129599283 15:76988858-76988880 GGGCTGGCAGTGAGGGGCCAGGG - Intergenic
1132229915 15:100173925-100173947 AGGCTGTCTGTGAATAGCTCAGG + Intronic
1132533455 16:465577-465599 GGGCGGCCTGTCAGTAGCCACGG + Intronic
1132589870 16:721955-721977 GGGCTGTCAGCGGGTGGCCAGGG - Intronic
1132834394 16:1945519-1945541 GGGCTGTCTGGAAGCGGCCATGG + Exonic
1135079928 16:19425356-19425378 GGCCTGTCTGTGAGCAGTCAAGG - Intronic
1135322686 16:21507678-21507700 GGGCTGTCTGTCAGTGGAGATGG - Intergenic
1136334163 16:29600815-29600837 GGGCTGTCTGTCAGTGGAGATGG - Intergenic
1138776865 16:59733996-59734018 GGGCTGTCAGTGAGGAGCAAAGG - Intronic
1139395417 16:66634825-66634847 GGGCTCTCAGTGACTAGCCCAGG + Intronic
1141681218 16:85545082-85545104 GGGCTGTCTGAGATTACCAATGG + Intergenic
1142402986 16:89870744-89870766 GGGAAGTCTCTGAGTAGGCAGGG + Exonic
1143329145 17:6121087-6121109 GGGCTTCCTGTGTGTAGCCCTGG + Exonic
1146405076 17:32529707-32529729 GGGCTGTCTGAGAGAAGACAGGG + Intronic
1148046656 17:44748924-44748946 GGTCTGTCTGTGGGCTGCCAGGG - Intronic
1148637222 17:49158098-49158120 GGGCTGTCTGTGTGCAGAAAAGG + Intronic
1149599075 17:57881718-57881740 GGGCTGACTGCCACTAGCCATGG - Intronic
1152333316 17:79685940-79685962 GGCCTGTCTGTGAAGAGCCATGG - Intergenic
1152503778 17:80732415-80732437 GTGCTCTCTGTGTGTTGCCAGGG + Intronic
1152721376 17:81925357-81925379 GGGCTGTCTGTGTTCAGGCACGG - Intronic
1152840711 17:82566340-82566362 GTGCTGTCTGAGAGTCGCCCCGG + Intronic
1203170101 17_GL000205v2_random:140647-140669 GGGCTGTGGGAGAGTAGCCCGGG + Intergenic
1157568069 18:48693479-48693501 GGGCTGTCACTGAGCAACCAGGG + Intronic
1157614891 18:48980621-48980643 AGGCTGGCTGTGAGTCTCCATGG - Intergenic
1157785514 18:50478473-50478495 GGGGTGTCTGTCTTTAGCCATGG - Intergenic
1159954565 18:74510185-74510207 GGGCTGTCTGGGGGCAGCCTGGG + Intronic
1160226723 18:77017582-77017604 GGGCTCTCCGGGAGCAGCCATGG - Intronic
1163371469 19:16903583-16903605 GGGCTGTTTGTGAGTGCCAAGGG - Exonic
1164902635 19:31941114-31941136 GGGTTATCTGTGTGCAGCCAAGG - Intergenic
1165079535 19:33299500-33299522 GCGGTGTGTGTGAGTGGCCAGGG + Intergenic
1165309343 19:35021219-35021241 CGTCAGTCTGTGAGTAGACAGGG + Intronic
1165421300 19:35723266-35723288 GTGCTGTGTGTGAGTAGCTGGGG + Exonic
1165423360 19:35732971-35732993 GGGCTGGCTGCCATTAGCCAGGG - Exonic
925970759 2:9105117-9105139 GGGGTGGCTGTGAGAAGCGAAGG + Intergenic
926504732 2:13699627-13699649 AGGCTGTCAGAGAGTGGCCAAGG - Intergenic
930036195 2:47086736-47086758 GGCCTGTCTGAGAGCAGCCCGGG + Intronic
932325744 2:70860479-70860501 GGGCTGGCTGAGATGAGCCATGG - Intergenic
932434948 2:71697624-71697646 GGGCTGTCTGGGTGTCACCAAGG + Intergenic
934716294 2:96546599-96546621 AGGATGGCTGTGAGTAGCCTAGG + Intronic
935607190 2:104982996-104983018 AAGGTGTCTGTGAGAAGCCAAGG - Intergenic
937660209 2:124422032-124422054 GTGCTGGCTGTTAGTAGACAAGG - Intronic
942088399 2:172464080-172464102 GGGCTGACTGTGACTGTCCAGGG + Intronic
945949508 2:216025297-216025319 GGGCTGTCTGTGGGTAGTAGAGG - Intronic
946169528 2:217886436-217886458 GGGCTGTCTGTTACTACCCAAGG + Intronic
946202878 2:218081177-218081199 GAGCTGTCTGTCAGTGGCCCAGG - Intronic
948492940 2:238325260-238325282 AGGCTGTCTGTGAGGTGACATGG + Intronic
948767655 2:240231782-240231804 GAGCAGTCAGTAAGTAGCCAAGG + Intergenic
948846994 2:240687929-240687951 GGGCTGGCTGTGAGGACACAGGG + Intergenic
1168986456 20:2053140-2053162 GGCCTGTCTCTGTATAGCCATGG - Intergenic
1170468878 20:16648592-16648614 GGCCTTTGTGTGAGAAGCCAAGG - Intergenic
1172025628 20:31946368-31946390 GGGCAGCCTGTGAGTGGCCCTGG - Intronic
1174380209 20:50151412-50151434 GGGCTGTCTGAAAGTAGGTAGGG + Intronic
1174841392 20:53904713-53904735 GGGTTGGCTGTGAGGAGCCAGGG - Intergenic
1178358014 21:31924391-31924413 TGGGTTCCTGTGAGTAGCCAAGG + Intronic
1179122437 21:38560370-38560392 GGGCTGTCTGGGATGAGGCAGGG - Intronic
1179474812 21:41636386-41636408 GGGCTCCCTGTAAGAAGCCAGGG - Intergenic
1181106233 22:20577377-20577399 GGGCTGCCTGTGAGAAGTCTAGG - Intronic
1181937417 22:26448891-26448913 CGGCTCTCTGTGAGGAGACAGGG - Intronic
1182140189 22:27948144-27948166 GGGCTGTCTCCAAGTAGCCTAGG - Intergenic
1183583855 22:38740824-38740846 GGCCTGTCTTTGAGGTGCCATGG - Intronic
949535730 3:4995050-4995072 AGGCAGACTGTGAGAAGCCACGG - Intergenic
953847312 3:46438141-46438163 GGGCAGACAGTGAGTAGCTAAGG + Intronic
954797945 3:53171128-53171150 GGGGCCTCTGTGAGGAGCCAGGG - Intronic
954829870 3:53411302-53411324 GGTCTTTCTGTGAGTAGCAGTGG + Intergenic
955688842 3:61570880-61570902 GCTCTGTCTGTGGGTAGCTAAGG + Intronic
961507253 3:127378258-127378280 GGCTTGTCTGTGGGAAGCCAGGG - Intergenic
966739700 3:183221219-183221241 GGGGGGTCTGTGAGGAGCCGTGG - Intronic
968058067 3:195708264-195708286 GGCCTGTATGTGAGTTACCAGGG - Intergenic
968550889 4:1222910-1222932 GGGCTGTGTCTGTGTGGCCAGGG - Intronic
968730934 4:2268878-2268900 TGGGTGCCTGTGAGGAGCCAGGG + Intergenic
975668116 4:76754147-76754169 GGTCTTCCTGTGAGCAGCCAGGG + Intronic
977408258 4:96628828-96628850 GGGATATCAATGAGTAGCCATGG - Intergenic
979600059 4:122577502-122577524 CGTCTGTCTGTGAGTCCCCAGGG - Intergenic
981535063 4:145791215-145791237 TGGCTGTCTGTGAGGAAGCAGGG - Intronic
985801114 5:2005749-2005771 CGGCTGTCTGGGAGCGGCCACGG + Intergenic
985807796 5:2059905-2059927 GGGCTGACTGGGAGGAGCCCAGG + Intergenic
986574363 5:9197030-9197052 GGGCTGTCCATGAGGGGCCAGGG + Intronic
991950135 5:71939280-71939302 GGGATGTCTGTGAGTAGCCAGGG + Intergenic
996385514 5:122906205-122906227 GGGCTGTCTGGGAACAGCCAGGG + Intronic
997146992 5:131445758-131445780 GGGGTCTCTTTGAGTTGCCAAGG + Intronic
997147938 5:131457747-131457769 TTGCTATCTGTGAGGAGCCATGG + Intronic
998082412 5:139287771-139287793 GGCCTGTTTGTGAGCAGGCATGG - Intronic
999651131 5:153768447-153768469 GGACTGGCTGTGAGGAGCCCTGG - Intronic
1003327474 6:5103422-5103444 TGGCTGTGTGTCAGTAGCCCAGG - Intronic
1004525123 6:16400289-16400311 GGGCTGTCTGCAGGGAGCCAAGG - Intronic
1008924262 6:56875710-56875732 GGGCTGTCTGTGGCTACCCCTGG + Intronic
1013733010 6:113191384-113191406 TGGATTTCTGTGAGTACCCAAGG - Intergenic
1017461412 6:154654599-154654621 AGGCTGGCTGTGTGTAGCGATGG - Intergenic
1018462867 6:164015692-164015714 GGGCTGTCTGGGAGAAGCCACGG - Intergenic
1019909328 7:4089594-4089616 GGGCTGTCTCTGAGTGTCCAGGG + Intronic
1023625488 7:42111391-42111413 GTGTTGTCAGTGAGTAGCTATGG + Intronic
1024393335 7:48839575-48839597 GGGATGTCTGTGAATACCAATGG + Intergenic
1025095336 7:56091841-56091863 GGCCTGTGTGTGAGCAGCCCAGG - Intronic
1028637193 7:93002775-93002797 GGGCTTTGGGTGAGTAGCAAAGG + Intergenic
1033350491 7:140558284-140558306 GGGGTGGCAGTGAGCAGCCATGG + Intronic
1036752778 8:11453910-11453932 GGGCTGTCACTGAGGAGCCCCGG - Intronic
1037003836 8:13752209-13752231 GGGCTGTCTGTAAAGAGTCAGGG - Intergenic
1037686973 8:21149116-21149138 GGGATGTCAGTGAGTCTCCAGGG - Intergenic
1037721152 8:21445122-21445144 AGGCTGACTCTGACTAGCCAAGG - Intergenic
1039419134 8:37420898-37420920 GCGCTGACTGTGAGGATCCAGGG - Intergenic
1039786660 8:40840245-40840267 CAGCTGTCAGTTAGTAGCCATGG - Intronic
1040014867 8:42691838-42691860 GGGCTCTCTGAGAGCAGCCAGGG - Intergenic
1042255345 8:66797147-66797169 TGGCTGTATTTGGGTAGCCAGGG + Intronic
1043566081 8:81549440-81549462 GCTCTGTCTGTGAGTGGCGAAGG - Intergenic
1048994972 8:139788576-139788598 GGGCTGTCGTGGAGTGGCCACGG - Intronic
1049203408 8:141352435-141352457 GGGCTGTGTGTGAAGAGGCAGGG + Intergenic
1049335041 8:142079803-142079825 GGGCTGTGAGTGAGGGGCCAAGG + Intergenic
1052188969 9:25634185-25634207 GGGTTATCTGTGAGTAGACATGG - Intergenic
1057849683 9:98555822-98555844 GAGGTGTCTGTGAGTAGGCCTGG - Intronic
1058506748 9:105674170-105674192 GGGCTGTCTGAAAGCAGCTATGG + Intergenic
1060635848 9:125199469-125199491 GGGTTGTCTGTTTGTAACCATGG - Intergenic
1060671429 9:125473264-125473286 GGGCTGGCCGGGAGCAGCCAGGG + Intronic
1061233141 9:129326633-129326655 GGTCTGCCTGGGAGGAGCCAGGG + Intergenic
1062043912 9:134416509-134416531 GGGCCGTCTCTGTGTGGCCAGGG + Intronic
1062116370 9:134811384-134811406 GGCCCCTCTGTGAGTATCCATGG + Exonic
1203436033 Un_GL000195v1:138044-138066 GGGCTGTGAGAGAGTAGCCCGGG - Intergenic
1186069193 X:5799441-5799463 GGGCTGTCTGTGAATAAATATGG + Intergenic
1187550597 X:20301033-20301055 GGGCTGTCTGACAGTAGCTGTGG + Intergenic
1189626562 X:42903393-42903415 TTGCTGGCTGTGAGGAGCCAGGG - Intergenic
1190150587 X:47944227-47944249 TGGCTGTTTGGGAGTAGCCTGGG + Intronic
1200127232 X:153821568-153821590 CCACTGGCTGTGAGTAGCCAGGG - Intronic
1200239694 X:154487007-154487029 GGGCCGTCTGTGGGTATGCAGGG - Intergenic