ID: 1076701434

View in Genome Browser
Species Human (GRCh38)
Location 10:132275250-132275272
Sequence CTACTCACAGACAGCCCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701428_1076701434 -6 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701429_1076701434 -7 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701419_1076701434 26 Left 1076701419 10:132275201-132275223 CCCGTGCCCACCATGTCTCTGGG 0: 1
1: 0
2: 2
3: 27
4: 294
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701424_1076701434 16 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701427_1076701434 -5 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701422_1076701434 20 Left 1076701422 10:132275207-132275229 CCCACCATGTCTCTGGGCAGTGC 0: 1
1: 0
2: 1
3: 13
4: 247
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701423_1076701434 19 Left 1076701423 10:132275208-132275230 CCACCATGTCTCTGGGCAGTGCT 0: 1
1: 0
2: 1
3: 26
4: 309
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701421_1076701434 25 Left 1076701421 10:132275202-132275224 CCGTGCCCACCATGTCTCTGGGC 0: 1
1: 0
2: 9
3: 36
4: 303
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data
1076701430_1076701434 -10 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701434 10:132275250-132275272 CTACTCACAGACAGCCCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701434 Original CRISPR CTACTCACAGACAGCCCCAC AGG Intronic
No off target data available for this crispr