ID: 1076701439

View in Genome Browser
Species Human (GRCh38)
Location 10:132275263-132275285
Sequence GCCCCACAGGGCCGCTGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701427_1076701439 8 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701430_1076701439 3 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701428_1076701439 7 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701432_1076701439 -3 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701433_1076701439 -4 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701424_1076701439 29 Left 1076701424 10:132275211-132275233 CCATGTCTCTGGGCAGTGCTGCC 0: 1
1: 0
2: 2
3: 34
4: 416
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701429_1076701439 6 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data
1076701431_1076701439 -2 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701439 10:132275263-132275285 GCCCCACAGGGCCGCTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701439 Original CRISPR GCCCCACAGGGCCGCTGGTG GGG Intronic
No off target data available for this crispr