ID: 1076701440

View in Genome Browser
Species Human (GRCh38)
Location 10:132275264-132275286
Sequence CCCCCACCAGCGGCCCTGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701440_1076701457 27 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701457 10:132275314-132275336 GTGAGTCAGCAACAGTAGCAAGG No data
1076701440_1076701449 -4 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701440_1076701452 5 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701440_1076701450 -3 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701440_1076701451 -2 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701440 Original CRISPR CCCCCACCAGCGGCCCTGTG GGG (reversed) Intronic
900382583 1:2392105-2392127 TCCCGACCCGCGGCCCTGAGGGG + Intronic
900419706 1:2550621-2550643 GCCCCTCCAGCCGCCCTCTGGGG + Intergenic
900469636 1:2847322-2847344 CCCCCACCAGTCCCCCTGGGAGG - Intergenic
900896252 1:5484946-5484968 TCCCCAGCAGCAGCCCTGAGGGG + Intergenic
901587430 1:10309426-10309448 TCACCACCAGCAGCACTGTGTGG - Intronic
902331033 1:15731363-15731385 CCCCATCCAGCGGCCCTGACAGG + Intronic
902604137 1:17559499-17559521 CTCCTCCCAGCGGCCCTGGGGGG - Intronic
902656113 1:17869477-17869499 CCCCCACCTGCGGCTCCCTGTGG - Intergenic
903318380 1:22526628-22526650 GCCGCAGCAGCGGGCCTGTGGGG - Exonic
903834971 1:26197874-26197896 CCCCCACCAGCTGCCCAGAGAGG - Intronic
906942296 1:50265798-50265820 CCCCCACCAGCACATCTGTGGGG + Intergenic
907371086 1:54004174-54004196 GCTCCACCCGCGGCCCGGTGCGG - Intergenic
910051000 1:82973796-82973818 CCCCCATCACCAGCCCTGTGAGG + Intergenic
910406927 1:86899706-86899728 CGCCCAGCAGCCGCCCTGTCCGG - Intronic
914231360 1:145766771-145766793 CCCCGGCCAGCCGCCCTGTCCGG - Intronic
914343937 1:146782101-146782123 GACCCACCAGGAGCCCTGTGAGG + Intergenic
915839025 1:159200943-159200965 CGCCCCCCAGGGGCCCTGTGGGG + Exonic
916037412 1:160933547-160933569 CGCCCAGCCGCCGCCCTGTGTGG + Intergenic
917965645 1:180176837-180176859 GCACCAACAGCGGCCTTGTGAGG - Intronic
918022740 1:180710929-180710951 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
918993956 1:191732181-191732203 GCTCCACCTGCGGCCCGGTGTGG + Intergenic
919794811 1:201315170-201315192 TCCCAACCAGAGGCCCTGAGTGG + Intronic
920385840 1:205569605-205569627 CCCCCACCCACCGCCCCGTGGGG + Intronic
921212999 1:212915922-212915944 CCCCACCCAGTGGCCCAGTGAGG + Intergenic
922743749 1:228031373-228031395 CCCCAGCCAGCAGCTCTGTGAGG - Intronic
924058344 1:240145307-240145329 CCCCCAGCGGCGGCCCTCAGCGG - Intronic
1063300316 10:4844864-4844886 CCTTCACCTGCGGCCCCGTGCGG - Intronic
1063393686 10:5666604-5666626 CCCCGCCCAGCGGCCCCGCGCGG - Intergenic
1068607978 10:59026647-59026669 CCCCCATCACATGCCCTGTGAGG + Intergenic
1068668068 10:59697076-59697098 GCCCCGCCAGCCGCCCTGTCCGG + Intronic
1069090736 10:64196722-64196744 GCTCCACCTGCGGCCCGGTGTGG - Intergenic
1069862796 10:71481892-71481914 CCCACAGCAGCGGGCTTGTGTGG + Intronic
1070334787 10:75445691-75445713 CCTCCCCCAGGGGCCCTGAGTGG + Intronic
1074080314 10:110163190-110163212 CACCCACCGGTGTCCCTGTGAGG - Intergenic
1075114786 10:119617087-119617109 CCTCCACCAGCGCCCCCGCGTGG - Intergenic
1076258898 10:129050441-129050463 CCCTCACCAGGGCTCCTGTGGGG + Intergenic
1076701440 10:132275264-132275286 CCCCCACCAGCGGCCCTGTGGGG - Intronic
1077043422 11:534422-534444 CTGCCAGCAGCTGCCCTGTGGGG - Intronic
1077058801 11:608827-608849 CCCCCACCAGCAGCCTGGAGAGG + Exonic
1077228234 11:1447551-1447573 CCCCAGTCAGCAGCCCTGTGTGG - Intronic
1077247731 11:1547509-1547531 CCGCCACCAGCTGCCCGGAGAGG + Intergenic
1080416403 11:32073369-32073391 GCCCCAGCAGAGGCCCTGAGGGG - Intronic
1081604458 11:44518657-44518679 CCCCCACCAAGAGCCCTCTGAGG - Intergenic
1081783215 11:45727865-45727887 CCCAGACCAGTGGCCCTTTGTGG - Intergenic
1081991324 11:47339182-47339204 CCCCCAGCAGGGTCCCTGTGGGG - Intronic
1082002280 11:47399951-47399973 CCATCACCAACAGCCCTGTGGGG + Intergenic
1082833740 11:57638104-57638126 CCTTCACCTGCAGCCCTGTGCGG + Intergenic
1083603228 11:63961685-63961707 CCACAGCCAGCAGCCCTGTGTGG - Intergenic
1083800977 11:65046100-65046122 CAGTCACCAGAGGCCCTGTGAGG + Exonic
1084654883 11:70509363-70509385 CCTCCCCCAGGGGCCCAGTGTGG + Intronic
1085260089 11:75199658-75199680 CTCCCATCTGAGGCCCTGTGTGG + Intronic
1085793927 11:79519687-79519709 CCCCCACCCGCCGCCCAGTGTGG - Intergenic
1087182112 11:95151138-95151160 CCCCGACCAGCGGCCCTTCCGGG - Intergenic
1090284541 11:125488388-125488410 CCCCCACCATGGGCCAGGTGTGG + Intronic
1091223859 11:133946350-133946372 CCCCCACCAGCTGCCCTCCATGG + Intronic
1091400481 12:177833-177855 CACCCCCCACCGGCCCTCTGGGG - Exonic
1091912504 12:4243404-4243426 CCCCCACCAGAAGCCATGGGAGG - Intergenic
1094152565 12:27301548-27301570 AACCCACCAGCGGCCGGGTGCGG - Intronic
1101455808 12:104828636-104828658 CCCCCATCACATGCCCTGTGAGG + Intronic
1101723217 12:107368700-107368722 CCCCCACCAGTGGCGCGGAGGGG + Intronic
1102201189 12:111059208-111059230 CCCCCTCCAGCTGACCAGTGTGG - Intronic
1102680046 12:114685011-114685033 GCCCCACCCGCAGCCATGTGCGG + Intergenic
1103045421 12:117731345-117731367 CGCCCAGCAGCCGCCCTGTCTGG + Intronic
1103212530 12:119177372-119177394 CCCTCACCAGCAATCCTGTGAGG - Intergenic
1104376483 12:128268164-128268186 ACCTCACCAGCGGTCCTGTCCGG + Intronic
1105483005 13:20796939-20796961 GCCACACTAGAGGCCCTGTGTGG - Exonic
1106231924 13:27827019-27827041 CACCCATCAGCACCCCTGTGTGG - Intergenic
1106758577 13:32846088-32846110 CCCCCACCTGCACCCCAGTGGGG - Intergenic
1108520624 13:51243974-51243996 CCCCCATCAACGGCACTGAGTGG - Intronic
1108856468 13:54799673-54799695 GCTCCACCTGCAGCCCTGTGGGG - Intergenic
1110136500 13:72073771-72073793 CCCCCACCCGCTTCCATGTGAGG + Intergenic
1110852771 13:80263422-80263444 CCCCCACCCGCTGCTCTGTCCGG + Intergenic
1113747327 13:112754411-112754433 TCCCTCCCAGCGGCCCTGTGAGG + Intronic
1113868126 13:113542501-113542523 CTCCCACCACTTGCCCTGTGTGG - Intronic
1113946133 13:114044543-114044565 CTCCCACCGGCAGCCCTGGGCGG + Intronic
1113950195 13:114067168-114067190 CCCCCACCTGCGGTACTCTGGGG + Intronic
1114549640 14:23525515-23525537 CCCCCACCTGAGGCCCTCGGGGG - Exonic
1114732423 14:25007592-25007614 CCCCCACCGGAAGCTCTGTGAGG + Intronic
1119320908 14:73729743-73729765 CCCCCATCCTCAGCCCTGTGCGG - Exonic
1119722013 14:76898105-76898127 GCCCCGCCAGCCGCCCTGTCCGG - Intergenic
1120193773 14:81462494-81462516 CGCCCACCAGCCGCCCTGTCCGG - Intergenic
1121175666 14:91889133-91889155 CCCCCACCAGTGCCCGTGGGAGG + Intronic
1122321473 14:100858442-100858464 CCCCCACCAGCTGGAATGTGGGG - Intergenic
1122389884 14:101373067-101373089 CCACCTCCAGAGGCCCGGTGTGG + Intergenic
1122408255 14:101512968-101512990 CCAACACCATCTGCCCTGTGGGG - Intergenic
1122540968 14:102497461-102497483 CCTCCACCAGGGTCCCTGCGGGG - Intronic
1122694519 14:103546283-103546305 CGCCCGCCAGCTGCCCTGTGTGG + Intergenic
1122996852 14:105269756-105269778 CCCCCACAGGAGGCCCAGTGAGG + Intronic
1123105514 14:105839464-105839486 TCCCCAGAAGCGACCCTGTGAGG - Intergenic
1123921390 15:25072247-25072269 CCGACATCAGAGGCCCTGTGAGG + Intergenic
1124554414 15:30711511-30711533 CCCCCTCCACTGGCTCTGTGAGG + Intronic
1124676832 15:31694166-31694188 CCCCCTCCACTGGCTCTGTGAGG - Intronic
1126730378 15:51675947-51675969 CACCCACCCTCTGCCCTGTGAGG - Intergenic
1127576226 15:60295108-60295130 GCCCCAGCAGGGGCACTGTGCGG + Intergenic
1127933366 15:63612604-63612626 CACCCACCAAGGGCCCTGTGGGG + Intronic
1128083047 15:64867568-64867590 CCCCCACCAGCAGCCATGGCTGG + Exonic
1129303013 15:74637396-74637418 CCCCCAACAGTGGCTCTGGGAGG + Intronic
1130946394 15:88552905-88552927 CGCCCGCCAGCCGCCCTGTCTGG - Intergenic
1131428713 15:92368744-92368766 CCCTGACCAGCAGCCCTGGGTGG + Intergenic
1132840846 16:1977914-1977936 CCCCAGCCAGCGGCCCTCAGTGG + Intronic
1133046783 16:3092535-3092557 CTCTCACCAGCGGCCCCGCGTGG + Exonic
1133102417 16:3487460-3487482 TCCCCAGCAGCTGCCCTGTCTGG + Intergenic
1134805275 16:17118878-17118900 CCTGCACCATCTGCCCTGTGTGG + Intronic
1136048891 16:27636825-27636847 TCCCCTCCAGCAGCCCTGGGAGG - Intronic
1136153614 16:28367972-28367994 CCCTCACCAACTGCCCTGCGGGG + Intergenic
1136209473 16:28747295-28747317 CCCTCACCAACTGCCCTGCGGGG - Intergenic
1138336632 16:56258627-56258649 TCCCCAGCAGCTTCCCTGTGGGG + Intronic
1139962563 16:70726294-70726316 CACCCACCAGCGGCCCGGCCCGG - Intronic
1141453468 16:84121220-84121242 CCCTCAACAGTGGCGCTGTGCGG + Intergenic
1141700176 16:85638794-85638816 CCCCCATCATCTGCCCTGGGAGG + Intronic
1141900779 16:86988895-86988917 CCTCCACCACCTGCCCTGTGTGG - Intergenic
1142171539 16:88625116-88625138 TCCCCACCAGCAGCCCTGTGAGG - Intronic
1142393227 16:89816272-89816294 CCCCCGCCGGCCGCCCTGTCAGG - Intronic
1142680713 17:1546614-1546636 CTCCCACCAGCCTCCATGTGTGG - Intronic
1144605159 17:16658352-16658374 CCCCCAGCAGGGACCCTGTATGG + Intergenic
1144812843 17:18011774-18011796 CCCACACCAGAGTCTCTGTGTGG + Intronic
1145249745 17:21290517-21290539 CCCTCAACAGCAGCCCTGAGAGG - Intronic
1145279095 17:21455428-21455450 CCCCCACCAGGGCCCCTGAATGG - Intergenic
1145398761 17:22515019-22515041 CCCCCACCAGGGCCCCTGAATGG + Intergenic
1146696014 17:34909597-34909619 CCCCCACCAAGGGCCCTCTGTGG - Intergenic
1147897442 17:43759867-43759889 CCCCCCGCCCCGGCCCTGTGTGG - Intergenic
1148243190 17:46013234-46013256 CCTCCAGCAGTGGCCTTGTGTGG - Intronic
1148566439 17:48635678-48635700 CCCCCACCAGGTGCCCGGTAGGG - Intergenic
1149304262 17:55333213-55333235 CCCCCACCACCGGGACTGTCAGG - Intergenic
1151474759 17:74339190-74339212 CTCCCACGAGGGGCCTTGTGGGG - Intronic
1151476475 17:74346867-74346889 CCCCAAACAGCTGACCTGTGGGG - Intronic
1152224779 17:79087630-79087652 CCCCTACCACTGGCCCTATGTGG - Intronic
1152356260 17:79809132-79809154 CCCCCACCAGGTGCACAGTGAGG - Intergenic
1152668031 17:81582828-81582850 CCCCCACCAGCTGGGCTCTGGGG + Intronic
1152801944 17:82334594-82334616 CCCCCATCATCTGCCCGGTGGGG - Intergenic
1154942901 18:21132486-21132508 GCTCCACCTGCGGCCCAGTGCGG - Intergenic
1154990211 18:21592574-21592596 GCCCCACCAGCCGCCCCGTCCGG - Intronic
1156655301 18:39278264-39278286 GCCCCACCAGCCTCCCTGTCTGG + Intergenic
1156766444 18:40662609-40662631 TCCCCACCACACGCCCTGTGAGG - Intergenic
1158646917 18:59255775-59255797 CGCCCAGCAGCCGCCCGGTGGGG + Intergenic
1160463882 18:79059515-79059537 CCCCCAGCAGAAGCCCTGGGGGG - Intergenic
1160828092 19:1089987-1090009 GCCCCCCCAACGGCCCTGTCTGG - Intronic
1160992967 19:1868195-1868217 CCCCCACCCCCTGCCCAGTGTGG + Intergenic
1161435253 19:4259015-4259037 CCCTCACCAGCCGCCTTCTGAGG + Intronic
1161699982 19:5789267-5789289 CCCCTCCCAGCAGCCCCGTGCGG - Exonic
1161792080 19:6366183-6366205 CCACCTCCAGCCTCCCTGTGAGG + Intronic
1162602104 19:11677000-11677022 CGCCCAGCAGCTGCCCTGTCTGG - Intergenic
1162800994 19:13110352-13110374 ACCCCACCAGGAGCCCTATGTGG + Intronic
1162818020 19:13207814-13207836 CGGCCACCAGCGGCCCTCGGAGG - Exonic
1164168529 19:22703052-22703074 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164168540 19:22703092-22703114 CGCCCAGCAGCCGCCCTGTCTGG - Intergenic
1164709150 19:30343068-30343090 CCCCCACCCTCGGCCCGGTGGGG + Intronic
1165900831 19:39168498-39168520 CCCCTCGCAGCAGCCCTGTGGGG + Intronic
1165939855 19:39409697-39409719 CCGCCTCCCGCGGCCCCGTGGGG - Intergenic
1166164922 19:40980683-40980705 GCCCCAGCAGAGGCTCTGTGTGG + Intergenic
1167049724 19:47070995-47071017 CCCCCACCCGCTGCCCTCGGAGG + Intronic
1167149037 19:47698589-47698611 CCCCCACCCTCCGCCGTGTGTGG + Intronic
1167419449 19:49394568-49394590 CCCCCACCACCTGTCCTCTGAGG - Exonic
1167482095 19:49739293-49739315 CCACCACCAGCACCTCTGTGGGG + Intergenic
1167498939 19:49835003-49835025 CCCCCACACGGCGCCCTGTGAGG + Exonic
1167592927 19:50414159-50414181 CCCCCATCAGGGTCCCTGCGTGG - Intronic
1167646798 19:50710429-50710451 CCCCCACCAGCTGCCCTTCAAGG + Intronic
1168659959 19:58157718-58157740 GCTCCACCTGCGGCCCTGTGCGG + Intergenic
925036409 2:690147-690169 ACCCCACATGCTGCCCTGTGAGG + Intergenic
925149454 2:1605263-1605285 TCCCCACCTGCTGTCCTGTGTGG - Intergenic
925316894 2:2933534-2933556 CAGACACCAGCGGCTCTGTGGGG - Intergenic
926083460 2:10006732-10006754 CTCTCACCATCGGGCCTGTGTGG + Intergenic
927673558 2:25088978-25089000 CGCCCACCATGGGCCCTGTGTGG + Intronic
927757837 2:25723352-25723374 GCCCGACCAGCTGCCCTGTCCGG - Intergenic
928312541 2:30222796-30222818 CCCTCACCAAGGGCCCTGGGTGG - Intergenic
928325059 2:30312918-30312940 CACCCACCTGCTGCCCTGAGAGG + Intronic
929481439 2:42312269-42312291 CCCCCACCATCGTCCCTGCCAGG + Intronic
930248009 2:49004451-49004473 CCCACACGAGGGGCCCTGTATGG - Intronic
931674205 2:64677684-64677706 CCCCTCCCAGCCACCCTGTGAGG + Intronic
932253805 2:70267027-70267049 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
932599319 2:73112934-73112956 CCGCGGCCAGCGGCCCGGTGAGG - Exonic
935218358 2:100991815-100991837 GCCCCACCATCTGCACTGTGTGG - Intronic
936076298 2:109403882-109403904 CCCCCACCATGGCCACTGTGAGG + Intronic
937990769 2:127661001-127661023 CCCCTAACAGCAGCTCTGTGAGG + Intronic
938112987 2:128581556-128581578 CTCCCACCATAGGCTCTGTGAGG + Intergenic
938573673 2:132584987-132585009 CCCCCACCATCAGGGCTGTGTGG + Intronic
940140131 2:150484894-150484916 CCCCAACCGGCAGCCCTGTTTGG - Intronic
941125262 2:161576679-161576701 CCCCCATCACACGCCCTGTGTGG + Intronic
941793202 2:169575111-169575133 GCCCCGCCAGCCGCCCTGTCCGG - Intergenic
941934679 2:170973661-170973683 CCCCGCCCAGGGGCCCTGCGAGG - Intergenic
942444526 2:176069193-176069215 CTCCCAGCAGGGGCCCTGGGAGG + Intergenic
943773454 2:191742156-191742178 CCCCCGCCAGCCGCCCCGTCCGG + Intergenic
946333101 2:219021482-219021504 CCCCACCTAGCAGCCCTGTGAGG + Intronic
946400175 2:219464457-219464479 CCCAGACCAGCGGCGCTTTGCGG + Exonic
946418303 2:219551529-219551551 CCTCTACCAGCAGCCGTGTGTGG + Exonic
946788459 2:223273699-223273721 GCCCCAGCTGCTGCCCTGTGGGG - Intergenic
1170270918 20:14526685-14526707 CCCCCACCACATGCCCTGTGAGG - Intronic
1171430174 20:25078045-25078067 CCCCCAGCAGCGCCCACGTGCGG + Intronic
1172907358 20:38379198-38379220 CCCCGGCCAGCCGCCCTGTCCGG + Intergenic
1172910779 20:38407598-38407620 CGCCCAGCAGCCGCCCTGTCCGG + Intergenic
1174392469 20:50226466-50226488 CCACCCCCAGCAGCCCTGAGAGG - Intergenic
1174397855 20:50259011-50259033 CCCCACTCAGAGGCCCTGTGAGG + Intergenic
1174415094 20:50360963-50360985 CCCCCCCCTGAGGCCCTGCGTGG + Intergenic
1174546598 20:51330564-51330586 CTCGCACCAGCAGCCCTATGAGG + Intergenic
1175944266 20:62551443-62551465 CCCCCACCAGCACCTCAGTGGGG - Intronic
1176385607 21:6137429-6137451 CCACCCCCAGCAGCCCTGCGAGG - Intergenic
1176387705 21:6147224-6147246 CCTCCACCAATGGCCTTGTGAGG + Intergenic
1179735767 21:43391024-43391046 CCTCCACCAATGGCCTTGTGAGG - Intergenic
1179737866 21:43400823-43400845 CCACCCCCAGCAGCCCTGCGAGG + Intergenic
1180163696 21:46009366-46009388 CCTCCACCAGCTCCCCTGTGAGG + Intergenic
1180190294 21:46159656-46159678 CCGCCCCGGGCGGCCCTGTGTGG + Intergenic
1180199458 21:46215781-46215803 CCCCCACCAGGAGCTCTATGTGG - Exonic
1180867160 22:19126248-19126270 CCCCCACTGGCAGCCTTGTGGGG - Intergenic
1181618409 22:24070999-24071021 CCTCCACCACTGGCCTTGTGCGG + Exonic
1183367365 22:37414056-37414078 ACCCCACCAGCCACCCTGGGAGG - Intronic
1183538810 22:38417925-38417947 CACCCCCCATCTGCCCTGTGAGG - Intergenic
1183897358 22:40980042-40980064 CCCCCACCAGGCCCGCTGTGGGG + Intergenic
1184663106 22:45974630-45974652 TCCCCTCCAGGGGCCCTGGGTGG + Intronic
1185153453 22:49179513-49179535 CCCTCATCAGCTGCACTGTGTGG + Intergenic
949770070 3:7569004-7569026 GCTCCACCTGCGCCCCTGTGTGG + Intronic
950687374 3:14628119-14628141 CCAGAACCAGAGGCCCTGTGGGG + Intergenic
952298729 3:32085293-32085315 CCCCCATCACATGCCCTGTGAGG - Intergenic
953636713 3:44670716-44670738 CCCCCAACACAAGCCCTGTGAGG + Intergenic
954384277 3:50236235-50236257 CTCCCACCACCAGCCCTCTGCGG - Exonic
954621776 3:52000566-52000588 CCCTCACCTGAGGCCTTGTGGGG - Intergenic
954659499 3:52219420-52219442 TCCCCTCCAGAGGCCCTGAGTGG + Intergenic
954856994 3:53652655-53652677 CTACTACCAGTGGCCCTGTGGGG - Intronic
961555392 3:127693459-127693481 CCGCCACCAGCGTCCCTGACTGG + Intronic
963102440 3:141620326-141620348 CTCCCACCCCCAGCCCTGTGGGG - Intergenic
963770121 3:149380198-149380220 GCCCGACCAGCCGCCCCGTGCGG + Intergenic
966732521 3:183162780-183162802 CCCCGCCCAGCGGCCCTGGGCGG - Exonic
968074559 3:195809399-195809421 CCTCCAGCAGCTGCCCTGTGGGG + Intronic
968490097 4:885504-885526 CCCACCCCAGCAGCCCTGCGGGG + Intronic
968570002 4:1334305-1334327 CCCCCACCTGCCACCCTGTAGGG + Intronic
968652255 4:1764913-1764935 CCCCCACCTCCAGCCCTGCGAGG + Intergenic
969348612 4:6584928-6584950 CCCCCACCGGCTGCCCTGTCTGG + Intronic
972270741 4:37509278-37509300 CGCCCAGCAGCCGCCCTGTCTGG - Intronic
972304763 4:37820634-37820656 CCCCGACCAGCCGCCCCGTCCGG + Intergenic
972642026 4:40933716-40933738 CACCTCCCAGCGTCCCTGTGCGG - Intronic
972739001 4:41873537-41873559 CCCCCGCCACCGGCCATTTGGGG + Intergenic
973878185 4:55241867-55241889 GCTCCACCTGCGGCCCAGTGTGG + Intergenic
975439876 4:74399013-74399035 GCTCCACCTGCGGCCCGGTGGGG - Intergenic
976152322 4:82104793-82104815 CACCCACCAGGGGCCCTTGGTGG - Intergenic
976658135 4:87510902-87510924 CCCTCACCAGCGTCCAGGTGTGG - Intronic
977338662 4:95729875-95729897 CCCCCAGCAGCATCCCTGTGGGG + Intergenic
978327467 4:107575512-107575534 CCCCCAGCACATGCCCTGTGAGG + Intergenic
980742921 4:136975028-136975050 ACCACAGCAGCAGCCCTGTGTGG + Intergenic
982504234 4:156197390-156197412 CCCCCACCACCGGCCCTGCAAGG + Intergenic
985293641 4:188411899-188411921 CCCCCACAGACGCCCCTGTGCGG - Intergenic
985830243 5:2222646-2222668 CCACAACCAGTGGCCCTCTGTGG - Intergenic
985897355 5:2756539-2756561 CGCCCACGAGCGGCCCAGCGTGG - Intergenic
985938437 5:3114445-3114467 GCAGCACCAGCGGCCTTGTGTGG - Intergenic
986738141 5:10682590-10682612 CACCCACCAGCGTCCCTGCAGGG + Intronic
987126843 5:14820986-14821008 CTCCCACCTGAGCCCCTGTGAGG - Intronic
988357610 5:30198794-30198816 CCCCCACCAGCTACCCTGATGGG - Intergenic
989574749 5:42979452-42979474 CGCCCAGCAGCCGCCCTGTCTGG + Intergenic
990951694 5:61304771-61304793 GCCCCACGAGCAGCGCTGTGAGG + Intergenic
995872171 5:116755234-116755256 CTCCCTCCTGCTGCCCTGTGAGG + Intergenic
997377339 5:133406474-133406496 TTCCCACCAGCAGCCCTGAGGGG - Intronic
997905127 5:137808780-137808802 CACCCACCAGGTGGCCTGTGTGG + Intergenic
999759885 5:154691745-154691767 CGCTCACCCGCGGCCCTATGGGG - Intergenic
1000087490 5:157900836-157900858 CTCCCACCACCTGGCCTGTGAGG - Intergenic
1002787992 6:418994-419016 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788004 6:419026-419048 CCCCCACCAGCACCCCCATGTGG + Intergenic
1002788028 6:419089-419111 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788042 6:419121-419143 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788055 6:419153-419175 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788069 6:419185-419207 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788083 6:419217-419239 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788096 6:419249-419271 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002788110 6:419281-419303 CCCCCACCAGCACCCCCATGCGG + Intergenic
1002813809 6:659981-660003 CCCCCCCCAACAGCCCTGAGTGG - Intronic
1003956749 6:11171476-11171498 GCTCCACCTGCGGCCCCGTGCGG + Intergenic
1004152539 6:13134220-13134242 GCCCCGCCAGCCGCCCTGTCCGG + Intronic
1004883766 6:20032722-20032744 GCTCCACCTGCGGCCCGGTGTGG + Intergenic
1008230756 6:48983379-48983401 GCTCCACCTGCGGCCCTGTGTGG - Intergenic
1008230962 6:48984316-48984338 GCTCCACCTGCGGCCCTGTGCGG + Intergenic
1008647616 6:53531059-53531081 TCCTCCCCAGCAGCCCTGTGAGG - Intronic
1009930349 6:70170256-70170278 CTCCCACCAGCTGTCCTGTAGGG + Intronic
1010513193 6:76744580-76744602 GCCCCGCCAGCCGCCCTGTCCGG + Intergenic
1011474207 6:87736067-87736089 CGCCCAGCAGCTGCCCTGTCTGG - Intergenic
1011559429 6:88599783-88599805 CCTCCACCAGAGGCACTGGGAGG + Intergenic
1013503010 6:110771146-110771168 GCCCCACTAGGGGCTCTGTGTGG + Intronic
1014844442 6:126258245-126258267 CCTCCTCCTGCGGCCCTGGGGGG + Intergenic
1017980197 6:159394544-159394566 CCCCCATCACATGCCCTGTGAGG + Intergenic
1018696929 6:166397726-166397748 CCCGCACCACCAGCCCAGTGGGG + Intergenic
1018907748 6:168085214-168085236 CCCCAACCTGAGGGCCTGTGGGG + Intergenic
1019179508 6:170177562-170177584 CCCCCTCCAGCGTCTCTCTGGGG - Intergenic
1019369368 7:652937-652959 CCACCACCAACCACCCTGTGTGG - Intronic
1020677326 7:11197532-11197554 CCCCAACCAGCTGCCCACTGAGG + Intergenic
1022015498 7:26345495-26345517 CCCCTTCCAGAGGCCCTGTGGGG + Intronic
1026164324 7:67896591-67896613 CCCCCACCCGTCGCCCCGTGAGG - Intergenic
1026850405 7:73719800-73719822 CCCGCACGAGCAGCCCCGTGGGG + Intergenic
1026894125 7:74000276-74000298 CCCCCACCCGCCGCCCCGTGAGG - Intergenic
1027371326 7:77509796-77509818 CCCCGGCCAGCCGCCCTGTCCGG + Intergenic
1027877288 7:83787244-83787266 ACACCCCCAGTGGCCCTGTGTGG + Intergenic
1029127326 7:98303613-98303635 CCCACACCAGGGCCTCTGTGCGG + Intronic
1029712685 7:102308252-102308274 CTCCTCCCAACGGCCCTGTGAGG - Intronic
1034202901 7:149293566-149293588 GCCCCACTAGAGGCGCTGTGAGG - Intronic
1034270279 7:149800330-149800352 CCCCGGCCAGACGCCCTGTGAGG + Intergenic
1034306663 7:150049130-150049152 CGCGCTCCAGCGCCCCTGTGTGG + Intergenic
1034483240 7:151339854-151339876 TCCCCAGCAGTGGCCCTCTGTGG + Intergenic
1034800182 7:154051513-154051535 CGCGCTCCAGCGCCCCTGTGTGG - Intronic
1034874094 7:154709920-154709942 CACCCATCAGGGGCCATGTGTGG + Intronic
1034921568 7:155087614-155087636 CCCCCACCCCCGGCACAGTGGGG - Intergenic
1035251117 7:157597800-157597822 CGCCCACCTGCCGTCCTGTGGGG + Intronic
1035432014 7:158829491-158829513 CCCGCGCCAGCGCCCCTCTGAGG + Exonic
1036473794 8:9074933-9074955 CCCCCACCAGCGCCACAGTGAGG + Intronic
1036801435 8:11795175-11795197 GCTCCACCTGCGGCCCTGCGCGG + Intergenic
1037512954 8:19602461-19602483 TCCTCACCAGCGGCGTTGTGCGG - Exonic
1038229768 8:25689091-25689113 CCCCCACCCCCGGCCCTGGCCGG - Intergenic
1044969492 8:97605281-97605303 TCCCCACCAGCCGCCCCGTCTGG + Intergenic
1045299181 8:100896098-100896120 CCCCCACCAAAGCCCATGTGAGG + Intergenic
1046149276 8:110202524-110202546 GCTCCACCTGCGGCCCGGTGCGG - Intergenic
1048082915 8:131148522-131148544 CCCCCATCACATGCCCTGTGAGG - Intergenic
1051281038 9:15442369-15442391 CGCCCAGCAGCTGCCCTGTCTGG - Intronic
1052743334 9:32415334-32415356 TCCCAACCAGCTGCCCTGTGAGG - Intronic
1055243986 9:74218367-74218389 CCCCCATCACATGCCCTGTGAGG + Intergenic
1057265196 9:93612821-93612843 CACCCACCAGTGTCTCTGTGGGG + Intronic
1057582731 9:96302053-96302075 GGCACACCAGCAGCCCTGTGAGG + Exonic
1058379502 9:104362851-104362873 GCTCCACCTGCGGCCCAGTGTGG - Intergenic
1059344087 9:113616507-113616529 CCTCCAGCAGCAGCTCTGTGAGG + Intergenic
1059766165 9:117385945-117385967 CCCCCACCATTGCCCCTTTGGGG - Intronic
1061059927 9:128245182-128245204 CCTCCCCCAGCCGCCCTCTGGGG + Intronic
1061411540 9:130424768-130424790 CCCGCATCAGAGGCCCTGGGTGG - Exonic
1062166942 9:135112646-135112668 CGCCCAAGAGTGGCCCTGTGCGG - Intronic
1203360546 Un_KI270442v1:217077-217099 CTCCCCCCACAGGCCCTGTGTGG - Intergenic
1189331872 X:40149071-40149093 CCCCCACCAGCCTGCCTGGGGGG + Intronic
1189959012 X:46307201-46307223 CCCCCATCACATGCCCTGTGAGG - Intergenic
1192208988 X:69115358-69115380 CCCCCAACAGCGGCCCTAAGGGG + Intergenic
1195259305 X:103117059-103117081 GCTCCACCTGTGGCCCTGTGCGG - Intergenic
1195460207 X:105115699-105115721 GCTCCACCTGCGGCCCAGTGCGG - Intronic
1197694959 X:129540509-129540531 CCCCCACCCCCGGCCCTGCGCGG - Intronic
1198311149 X:135426412-135426434 CCCCACCCAGGGGCCCTATGGGG - Intergenic
1200147214 X:153932505-153932527 CCCCCACCAGAGAGCCTGGGTGG + Intronic
1201077896 Y:10200462-10200484 CCCCCACCACAGGTCCTGTGTGG + Intergenic