ID: 1076701442

View in Genome Browser
Species Human (GRCh38)
Location 10:132275265-132275287
Sequence ACCCCCACCAGCGGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701442_1076701449 -5 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data
1076701442_1076701458 30 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701458 10:132275318-132275340 GTCAGCAACAGTAGCAAGGCTGG No data
1076701442_1076701452 4 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701442_1076701457 26 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701457 10:132275314-132275336 GTGAGTCAGCAACAGTAGCAAGG No data
1076701442_1076701451 -3 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701442_1076701450 -4 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT No data
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701442 Original CRISPR ACCCCCACCAGCGGCCCTGT GGG (reversed) Intronic