ID: 1076701442

View in Genome Browser
Species Human (GRCh38)
Location 10:132275265-132275287
Sequence ACCCCCACCAGCGGCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701442_1076701452 4 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701442_1076701457 26 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701457 10:132275314-132275336 GTGAGTCAGCAACAGTAGCAAGG No data
1076701442_1076701458 30 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701458 10:132275318-132275340 GTCAGCAACAGTAGCAAGGCTGG No data
1076701442_1076701451 -3 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701442_1076701450 -4 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701442_1076701449 -5 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701442 Original CRISPR ACCCCCACCAGCGGCCCTGT GGG (reversed) Intronic
900115596 1:1026594-1026616 AGCCCCACCAGCGGCCTGGGTGG + Intronic
900350709 1:2233221-2233243 ACCCCCCCCACCAGCCCTGTTGG - Intronic
900391126 1:2434387-2434409 GCCCCTGCCAGAGGCCCTGTGGG - Intronic
900419705 1:2550620-2550642 AGCCCCTCCAGCCGCCCTCTGGG + Intergenic
900425519 1:2576650-2576672 AGCCCCTCCAGCCGCCCTCTGGG - Intergenic
901059288 1:6464708-6464730 ACCCCCACCAGCCTCCCAGGTGG - Exonic
902604138 1:17559500-17559522 ACTCCTCCCAGCGGCCCTGGGGG - Intronic
904000662 1:27336650-27336672 ACCCCTTCCATCGTCCCTGTTGG + Intergenic
915839024 1:159200942-159200964 GCGCCCCCCAGGGGCCCTGTGGG + Exonic
922422282 1:225468006-225468028 ACCCCCACCACCAGCCCAGGTGG + Intergenic
1063613602 10:7583809-7583831 ACAGCCACCAGAGGCCCTGCAGG + Intronic
1065351848 10:24802812-24802834 ACCCCCACCAGAGCCCCAGAGGG - Intergenic
1065589790 10:27252584-27252606 ACACACACCAGCGCCCCTGGCGG - Intergenic
1065981499 10:30902761-30902783 AGCTCCACCTGCGGCCCGGTGGG - Intronic
1067427625 10:46221629-46221651 ACCCCAAGCAGGGGTCCTGTGGG + Intergenic
1067583046 10:47457542-47457564 ACCCCAAGCAGGGGTCCTGTGGG + Intergenic
1076701442 10:132275265-132275287 ACCCCCACCAGCGGCCCTGTGGG - Intronic
1077308012 11:1876513-1876535 ACCCTCTCCAGCCGCCCTCTGGG + Intronic
1081991326 11:47339183-47339205 GCCCCCAGCAGGGTCCCTGTGGG - Intronic
1084876220 11:72135735-72135757 ACCTCCACCAACAGCGCTGTAGG - Exonic
1087182114 11:95151139-95151161 TCCCCGACCAGCGGCCCTTCCGG - Intergenic
1087631282 11:100653274-100653296 ACCCTCACCTGCGGTTCTGTTGG - Intergenic
1091728815 12:2864820-2864842 AACCCCACCAGCTGCTCTGGTGG + Intronic
1097195679 12:57241366-57241388 AACCCCACCAGCAGCAGTGTTGG - Intergenic
1098369265 12:69739289-69739311 ACGCCCACCAGCAGCCCAGGGGG - Intronic
1101723215 12:107368699-107368721 ACCCCCACCAGTGGCGCGGAGGG + Intronic
1102477859 12:113200531-113200553 CCCCCCACCAGGGGCCCCCTCGG + Intronic
1102953116 12:117043131-117043153 ACCCCCACCATCTGCCCTGTGGG + Intronic
1104052941 12:125208703-125208725 ACCCCCACCAAAGGCCTTGCAGG - Intronic
1104898378 12:132175299-132175321 ACCCCCACCACAGGCCTTGTGGG + Intergenic
1104963263 12:132498083-132498105 ACCCTCCCCAGAGGCCCTGTGGG - Intronic
1105830753 13:24161283-24161305 ACCCCCACGGCCGCCCCTGTAGG - Intronic
1108856469 13:54799674-54799696 AGCTCCACCTGCAGCCCTGTGGG - Intergenic
1112734408 13:102400720-102400742 ATCCCCACCCCTGGCCCTGTGGG + Intronic
1114549642 14:23525516-23525538 ACCCCCACCTGAGGCCCTCGGGG - Exonic
1115193217 14:30769327-30769349 ACCCCCACCAGAATCCCTGGTGG + Intergenic
1119734799 14:76975024-76975046 AAGCCCATCAGCGTCCCTGTTGG - Intergenic
1121449608 14:93998885-93998907 ACCCCCAGCACAGCCCCTGTTGG + Intergenic
1122318975 14:100841904-100841926 ACCCTCGCCAGCGCCTCTGTTGG + Intergenic
1122321475 14:100858443-100858465 ACCCCCACCAGCTGGAATGTGGG - Intergenic
1122540970 14:102497462-102497484 ACCTCCACCAGGGTCCCTGCGGG - Intronic
1123931133 15:25172152-25172174 ACCCACACCAGCTCCCCTGCAGG - Intergenic
1124604078 15:31157887-31157909 AAACACACCAGCTGCCCTGTGGG - Intronic
1125482598 15:40090872-40090894 ACCCCCAACATCGGCACTGAGGG - Exonic
1125933498 15:43616193-43616215 CCCCCTACCAGCTGCCCTGAAGG - Exonic
1125946596 15:43715655-43715677 CCCCCTACCAGCTGCCCTGAAGG - Intergenic
1127933365 15:63612603-63612625 GCACCCACCAAGGGCCCTGTGGG + Intronic
1127984853 15:64061295-64061317 AGCTCCACCTGCGGCCCTGGTGG + Intronic
1128150862 15:65362782-65362804 AGACCCACCAACGGTCCTGTCGG + Intronic
1129154317 15:73708352-73708374 ATTCCCCCCAGAGGCCCTGTGGG + Exonic
1129191066 15:73937832-73937854 ACCCCCACCAGTGGTGCTGGGGG + Intronic
1129709101 15:77811154-77811176 GCCCCCACCGGCCACCCTGTGGG - Intronic
1130149112 15:81297969-81297991 ACCCAGAGCAGAGGCCCTGTGGG + Intronic
1130867698 15:87946576-87946598 GCCACCACCAGCAGCCCTGAGGG + Intronic
1131032382 15:89197082-89197104 ACACCCACCTGTGGCCCTGAGGG - Exonic
1132592849 16:733893-733915 ACCCCCACCTGAGGCCCAGCGGG - Intronic
1134446279 16:14333643-14333665 ACACCCACCCCCGCCCCTGTGGG - Intergenic
1136005565 16:27326732-27326754 GCACCCACCAGCCTCCCTGTGGG - Intronic
1136687383 16:32003252-32003274 CCCTCCTCCAGCGGACCTGTTGG + Intergenic
1136787997 16:32946803-32946825 CCCTCCTCCAGCGGACCTGTTGG + Intergenic
1138552300 16:57754461-57754483 ACCCCCAGCTGAGGCCTTGTGGG - Intronic
1141090052 16:81123917-81123939 ACTCCCAGCAGCAGCTCTGTTGG - Intergenic
1203090224 16_KI270728v1_random:1208460-1208482 CCCTCCTCCAGCGGACCTGTTGG + Intergenic
1142469546 17:155742-155764 AGGCCCACCATCAGCCCTGTTGG + Intronic
1142750447 17:1984236-1984258 AGGCCCACCAGGTGCCCTGTAGG + Intronic
1146319130 17:31832847-31832869 ACCCCCAGCAGCAACCCGGTGGG - Intergenic
1147015721 17:37489967-37489989 ACCCCCACCCCCGGGCCTGCGGG - Intronic
1147148362 17:38498921-38498943 CCCTCCTCCAGCGGACCTGTTGG + Intronic
1147562541 17:41518070-41518092 GCCCCCACCTGTGCCCCTGTTGG + Intronic
1148323178 17:46769681-46769703 ACCCCTTCCGGCAGCCCTGTGGG - Intronic
1148566441 17:48635679-48635701 GCCCCCACCAGGTGCCCGGTAGG - Intergenic
1148875409 17:50684132-50684154 ACACTCACCAACGGCCCTGGAGG + Intronic
1151408471 17:73904557-73904579 ACCCCTACCAGCAGCCCTAGAGG - Intergenic
1151474760 17:74339191-74339213 ACTCCCACGAGGGGCCTTGTGGG - Intronic
1152668029 17:81582827-81582849 ACCCCCACCAGCTGGGCTCTGGG + Intronic
1152770252 17:82163147-82163169 TCCCCCAGCAGCGGCTCTCTAGG + Intronic
1152820606 17:82435878-82435900 ACCCCCTCCCCCAGCCCTGTTGG - Intronic
1160452986 18:78978599-78978621 ACCCCCGCCACCAGCCCTGCCGG + Intergenic
1160463884 18:79059516-79059538 ACCCCCAGCAGAAGCCCTGGGGG - Intergenic
1161594876 19:5146100-5146122 ACCCCCACCCCCGGCCGTGCAGG + Intronic
1162026122 19:7895085-7895107 ACCCCCTCCAGGGGCACTCTGGG - Intronic
1163200148 19:15760910-15760932 ACCCCACCCAGCAGCCCTCTTGG - Intergenic
1164709148 19:30343067-30343089 TCCCCCACCCTCGGCCCGGTGGG + Intronic
1165900829 19:39168497-39168519 ACCCCTCGCAGCAGCCCTGTGGG + Intronic
1166364689 19:42272557-42272579 ACCCCCACCAGGTGCCCTGGTGG + Intronic
1167482093 19:49739292-49739314 ACCACCACCAGCACCTCTGTGGG + Intergenic
925601064 2:5609130-5609152 ATCCACATCACCGGCCCTGTGGG - Intergenic
926753753 2:16219834-16219856 GCCCCCACCAGCAGGCCAGTTGG - Intergenic
927921838 2:26978437-26978459 ACCCCCACCCGCTTCCCTGAAGG + Intronic
928702287 2:33911133-33911155 ACAGCCACCAGCTGCTCTGTGGG - Intergenic
936483733 2:112908638-112908660 ACCCCAACCAGCAACCCTGCTGG - Intergenic
944766799 2:202872066-202872088 ACCCCCACCCCCGGACCTGCCGG + Intergenic
946788460 2:223273700-223273722 AGCCCCAGCTGCTGCCCTGTGGG - Intergenic
1169207970 20:3750502-3750524 ACCCCCACCCCGGGCCCTGCGGG + Intronic
1169345081 20:4823072-4823094 ACCCCCGCCAGGGGCCGTGTAGG - Intronic
1172846260 20:37931486-37931508 ACTCCCACCAGCGGGCTTGCAGG + Intronic
1172885802 20:38230027-38230049 ACCCCCAACAGCAGACCTCTAGG + Intronic
1175831446 20:61967165-61967187 CCCCTCACCAGCAGCCCTCTGGG - Intronic
1176062844 20:63179774-63179796 ACCCCCACCACCGCCGCTGCAGG + Intergenic
1176066638 20:63200520-63200542 TGCTCCACCAGCGGCTCTGTTGG + Intronic
1176180634 20:63747822-63747844 ACCCCCACCAGAGGCCCCCTGGG + Intronic
1178913623 21:36695084-36695106 ACCCCCACAAGCGGCCCAGGAGG + Intergenic
1180867162 22:19126249-19126271 ACCCCCACTGGCAGCCTTGTGGG - Intergenic
1181049900 22:20233560-20233582 ACCCCCACCTGCAGGCCTGGTGG + Intergenic
1181577588 22:23805202-23805224 CCCCTCACCAGCTGACCTGTGGG - Intronic
1184242968 22:43221127-43221149 ACCCACACCAACGGGGCTGTAGG - Intronic
953030743 3:39178140-39178162 ACCCCCACCTGCGTCCCGGAAGG - Intergenic
954709470 3:52498209-52498231 TCCCCCAGCAGCAGCTCTGTGGG + Intronic
954856995 3:53652656-53652678 ACTACTACCAGTGGCCCTGTGGG - Intronic
956873845 3:73443070-73443092 CGCCCCACCACCGGCCCAGTGGG + Intronic
961733364 3:128984059-128984081 ACCCCCACCTGGTGCCCAGTGGG - Intronic
968074557 3:195809398-195809420 TCCTCCAGCAGCTGCCCTGTGGG + Intronic
968490095 4:885503-885525 ACCCACCCCAGCAGCCCTGCGGG + Intronic
968570000 4:1334304-1334326 GCCCCCACCTGCCACCCTGTAGG + Intronic
969365080 4:6689646-6689668 TCTCACACCAGCGGCCATGTGGG + Intergenic
975439877 4:74399014-74399036 AGCTCCACCTGCGGCCCGGTGGG - Intergenic
977338660 4:95729874-95729896 ACCCCCAGCAGCATCCCTGTGGG + Intergenic
980956158 4:139431049-139431071 ATCCCCACCAGCCTCCCTGAAGG - Intergenic
985611477 5:892079-892101 GTCCTCACCAGAGGCCCTGTGGG + Intronic
986737847 5:10681302-10681324 GCATCCACCAGCGTCCCTGTAGG + Intronic
986737879 5:10681420-10681442 GCGCCCACCAGCGTCCCTGCAGG + Intronic
986737937 5:10681656-10681678 GCGCCCACCAGCGTCCCTGCAGG + Intronic
986738128 5:10682531-10682553 GCGCCCACCAGCGTCCCTGCAGG + Intronic
986738140 5:10682589-10682611 GCACCCACCAGCGTCCCTGCAGG + Intronic
988357612 5:30198795-30198817 CCCCCCACCAGCTACCCTGATGG - Intergenic
997297381 5:132776780-132776802 ACCCTCACCTGCGGCCCCGCGGG + Intronic
997438215 5:133890322-133890344 ACCCCAAGCAGCGGCCATGTGGG + Intergenic
999759886 5:154691746-154691768 ACGCTCACCCGCGGCCCTATGGG - Intergenic
1000021461 5:157322585-157322607 TCCCCCATCTGCAGCCCTGTTGG - Intronic
1001122409 5:168991552-168991574 ACCCCCAGCAGCAAACCTGTAGG + Intronic
1002175530 5:177399251-177399273 CCCTCCCCCAGCGGCCCTGATGG - Intergenic
1002824797 6:763160-763182 ACCCACACCACTGGCTCTGTTGG + Intergenic
1003402529 6:5802735-5802757 AAGCCCACCAGGGCCCCTGTGGG + Intergenic
1006067901 6:31475539-31475561 TCCACCACCAGTGGCGCTGTGGG - Intergenic
1007395567 6:41575811-41575833 ACCCCAACCAGTGTCCCTTTTGG + Intronic
1007432895 6:41786690-41786712 ACCCCCACTAGCTGCGGTGTAGG + Intronic
1009930348 6:70170255-70170277 TCTCCCACCAGCTGTCCTGTAGG + Intronic
1013488539 6:110621245-110621267 AGCCCCACCTGCGGTCCCGTTGG + Exonic
1019606010 7:1910590-1910612 ACCCCCACCAGTGGTCTTCTGGG + Intronic
1022015496 7:26345494-26345516 GCCCCTTCCAGAGGCCCTGTGGG + Intronic
1024020228 7:45361908-45361930 ACGCCCCACAGTGGCCCTGTGGG - Intergenic
1034564773 7:151904388-151904410 ACCCTGACCCGGGGCCCTGTGGG + Intergenic
1034996154 7:155578365-155578387 ACCCCCACCAGCAGCCCTCAGGG + Intergenic
1044601368 8:94008847-94008869 ACCCCCAGCTGCGGGTCTGTTGG + Intergenic
1047971537 8:130088586-130088608 GCTCCCTCCAGAGGCCCTGTGGG - Intronic
1050388147 9:5111656-5111678 CCGCCCAGCAGCGGCCCTGTGGG + Intronic
1051343215 9:16129900-16129922 AGCCCCAGCAGGGGCCCTCTTGG - Intergenic
1061663498 9:132146727-132146749 ACACAAACCAGCGGCCCTCTCGG + Intergenic
1062030036 9:134358105-134358127 ACACCCAGCAGCAGCCCTCTTGG - Intronic
1062437158 9:136551377-136551399 ACCCCCACCACAGGCTCTGCAGG - Intergenic
1187941970 X:24391436-24391458 ACCCCCAAGAGCTCCCCTGTGGG - Intergenic
1188094096 X:26001792-26001814 ACTCCCACCAGGGACCCTGAAGG + Intergenic
1192208986 X:69115357-69115379 ACCCCCAACAGCGGCCCTAAGGG + Intergenic
1192962549 X:76145503-76145525 ACCCCCACCGGCTGCCCGGTGGG + Intergenic
1192962984 X:76149584-76149606 ACCCCCACCGGCTGCCCGGTGGG - Intergenic
1200094140 X:153649437-153649459 ACCCCCACCAGTGGGGCTGCGGG + Exonic