ID: 1076701443

View in Genome Browser
Species Human (GRCh38)
Location 10:132275266-132275288
Sequence CACCCCCACCAGCGGCCCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 323}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701443_1076701450 -5 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701443_1076701457 25 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701457 10:132275314-132275336 GTGAGTCAGCAACAGTAGCAAGG No data
1076701443_1076701452 3 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701443_1076701458 29 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701458 10:132275318-132275340 GTCAGCAACAGTAGCAAGGCTGG No data
1076701443_1076701451 -4 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701451 10:132275285-132275307 GGTGGGTGCTGGGACCCCCGGGG No data
1076701443_1076701449 -6 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701449 10:132275283-132275305 GGGGTGGGTGCTGGGACCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701443 Original CRISPR CACCCCCACCAGCGGCCCTG TGG (reversed) Intronic
900136086 1:1117450-1117472 CAACTCCTCCAGAGGCCCTGAGG - Intergenic
900266029 1:1757634-1757656 CTGCCCCACCAGCGTCACTGAGG - Intronic
900391127 1:2434388-2434410 CGCCCCTGCCAGAGGCCCTGTGG - Intronic
900461554 1:2804463-2804485 CACCAGCACCAGCAGCCCCGAGG + Intergenic
900473112 1:2864100-2864122 CACCCCCACCACCCCTCCTGAGG - Intergenic
900580065 1:3404464-3404486 CACTGCCTCCAGCCGCCCTGGGG + Intronic
900896250 1:5484944-5484966 CGTCCCCAGCAGCAGCCCTGAGG + Intergenic
901039546 1:6355770-6355792 CGCCTACAGCAGCGGCCCTGGGG + Intronic
901985753 1:13074067-13074089 CACCACCACCATCGCCCCTTGGG - Intronic
901996056 1:13152700-13152722 CACCACCACCATCGCCCCTTGGG + Intergenic
902404456 1:16175174-16175196 CACTCCCTCCATGGGCCCTGGGG + Intergenic
902604139 1:17559501-17559523 GACTCCTCCCAGCGGCCCTGGGG - Intronic
905028945 1:34868788-34868810 CGCCCCCACCCCCGGCCCTGGGG - Exonic
905205770 1:36342105-36342127 CACTCCCACCCCCGGCCTTGAGG - Intronic
905740209 1:40363740-40363762 CTTCCCCACCAGCAGCCGTGTGG + Intronic
906658995 1:47569166-47569188 CACTCCCACCATCTGCACTGCGG - Intergenic
908534890 1:65067595-65067617 CACACCCACCTGCGCCCCCGGGG + Intergenic
909918268 1:81348002-81348024 CACTCCCACCACAGGCCCAGAGG + Intronic
910547389 1:88433360-88433382 CACTGCCACCATAGGCCCTGGGG - Intergenic
911543719 1:99190120-99190142 CACTCCCACCAGAAGCCCTATGG - Intergenic
913114618 1:115684828-115684850 CACCCACACCAGCAGCCCCTGGG - Intronic
915964342 1:160293433-160293455 CAGCCCCACCAGCTGCCCCAGGG + Exonic
916056166 1:161069973-161069995 CTCCCCCACCCTAGGCCCTGTGG - Intergenic
917450839 1:175146122-175146144 CACCCTCCCCAGCTTCCCTGGGG - Intronic
919464494 1:197912885-197912907 CACCCCCAGCAGCTCCCCGGAGG - Intronic
919835294 1:201569115-201569137 CAGAACCACCAGCAGCCCTGAGG + Intergenic
920054103 1:203180416-203180438 CCACACCACCAGCAGCCCTGGGG - Intronic
921891045 1:220353745-220353767 CACCCCCAGAAGCTGCCTTGGGG + Intergenic
922240252 1:223750992-223751014 CACCCCCGCCTGGGGCCCCGAGG - Intronic
923009214 1:230074898-230074920 CACTGCCTCCAGAGGCCCTGAGG - Intronic
923564618 1:235067641-235067663 CTTCCCCACCAGAAGCCCTGGGG + Intergenic
924677373 1:246193495-246193517 CAGCCCCAGCAGTGGCCTTGTGG + Intronic
1063231137 10:4066831-4066853 ACCTACCACCAGCGGCCCTGGGG + Intergenic
1063622995 10:7666677-7666699 GGCCCCCACCAGAGGCCCAGGGG - Intronic
1064025451 10:11845272-11845294 CACCCCCACCAGCGGAACCTCGG + Intronic
1064552950 10:16521066-16521088 CACCACCCCCAGCGCCCCGGCGG + Exonic
1065190248 10:23201204-23201226 CACCACCCCCAGCCGCCCTTGGG - Intergenic
1065351849 10:24802813-24802835 TACCCCCACCAGAGCCCCAGAGG - Intergenic
1065467717 10:26043591-26043613 CACCACCACCACAGGCCCTTAGG + Intronic
1065981500 10:30902762-30902784 CAGCTCCACCTGCGGCCCGGTGG - Intronic
1066480004 10:35786398-35786420 CACTCCCATCACAGGCCCTGAGG - Intergenic
1068461596 10:57336862-57336884 CACCCCAACCAGAAGCCCAGTGG + Intergenic
1068637370 10:59362608-59362630 CACCCCCAGCAGGGGCCCAGCGG + Intronic
1069222989 10:65906930-65906952 GACCCACAGCAGAGGCCCTGAGG + Intergenic
1069664506 10:70145753-70145775 CAGCGCCACCAGCGCCCCCGCGG + Exonic
1070148053 10:73788968-73788990 CCCCCCCACCCCCCGCCCTGGGG + Intronic
1070323717 10:75373937-75373959 GACCCCCACCAGGGGACCTGTGG + Intergenic
1072192596 10:93088634-93088656 CACTTCCACCAGATGCCCTGTGG - Intergenic
1075046631 10:119151408-119151430 CACCCCCACCCCCAGCCCTAGGG - Intronic
1075995510 10:126873466-126873488 CACCCCCTCCTGCTCCCCTGGGG + Intergenic
1076347312 10:129788345-129788367 CATCCCCTCCACAGGCCCTGGGG + Intergenic
1076566709 10:131404116-131404138 CTCCCCCACCAGCCATCCTGGGG + Intergenic
1076701443 10:132275266-132275288 CACCCCCACCAGCGGCCCTGTGG - Intronic
1076829973 10:132989148-132989170 CACCCCCCCCACCGGGCCTCGGG - Intergenic
1077057132 11:599667-599689 CAGCCCCACCAGCAGCCCTGTGG + Intronic
1077073177 11:687085-687107 CACCAGCACCAGCGCCCCAGCGG + Intronic
1077102736 11:829354-829376 CACCCCCACAAACATCCCTGCGG - Exonic
1077184146 11:1228910-1228932 CACCCCCTCCTGGGGTCCTGGGG - Intronic
1078175054 11:8964150-8964172 CTCCCCTACCACCGGCCTTGCGG - Intronic
1080416405 11:32073371-32073393 CTGCCCCAGCAGAGGCCCTGAGG - Intronic
1081672570 11:44950127-44950149 CACCTCCGTCCGCGGCCCTGCGG + Exonic
1081674962 11:44963342-44963364 CACCAGCACCAGCGGCCCTCAGG - Intergenic
1084581971 11:70029755-70029777 CACTCCCTCTAGAGGCCCTGGGG + Intergenic
1084682290 11:70673498-70673520 CACCCCCACCAGAGGGACTTGGG - Intronic
1084892756 11:72244458-72244480 CCTCCCCACCTGCGGCCCCGCGG + Intronic
1087715905 11:101608701-101608723 CACCCCCACCAACGACCCGGTGG - Intronic
1090387370 11:126364817-126364839 CACCCCCATCAGAGGGCCTGTGG + Intronic
1090389936 11:126382015-126382037 CACCCCCATCAGAGGGCCTGTGG + Intronic
1091217924 11:133914902-133914924 CAGCCCCACCTGGGGCCCTTTGG + Intronic
1091234621 11:134012841-134012863 TACCCACACCAGCAGCCCAGAGG + Intergenic
1091774511 12:3175633-3175655 CACTCCCTCCCGCGACCCTGGGG - Intronic
1091793177 12:3283137-3283159 CACCCCGCCCTGCTGCCCTGTGG + Exonic
1091995211 12:4987853-4987875 CACCGCCATCAGGGGCCTTGGGG + Intergenic
1094508598 12:31082421-31082443 CTCCCCCACCTGCAGCTCTGTGG - Intronic
1095382763 12:41615366-41615388 CCCTCCCACCACAGGCCCTGAGG + Intergenic
1096109742 12:49021563-49021585 CTTCCCCACCACCGGCCCTCAGG - Exonic
1096532331 12:52249749-52249771 CACCACCACCATCACCCCTGGGG - Intronic
1096957381 12:55540283-55540305 CAACCCCACAACAGGCCCTGGGG + Intergenic
1098369266 12:69739290-69739312 GACGCCCACCAGCAGCCCAGGGG - Intronic
1100061124 12:90576479-90576501 ATCCCCCAGCAGCAGCCCTGTGG - Intergenic
1101723214 12:107368698-107368720 GACCCCCACCAGTGGCGCGGAGG + Intronic
1102198571 12:111041950-111041972 CACCCCCAAAAGTGGGCCTGTGG + Intronic
1102953115 12:117043130-117043152 GACCCCCACCATCTGCCCTGTGG + Intronic
1103726048 12:122997838-122997860 CACCCTCACCAGGGGCACAGAGG + Intronic
1104017167 12:124968998-124969020 CAGACCCACCTGCGGTCCTGGGG - Intronic
1104860495 12:131921010-131921032 CACCCACGGCAGCGGCCCAGGGG - Intronic
1104898377 12:132175298-132175320 CACCCCCACCACAGGCCTTGTGG + Intergenic
1104927327 12:132320727-132320749 CGCCCCCACCAGGTGCCCTCGGG + Intronic
1104963264 12:132498084-132498106 CACCCTCCCCAGAGGCCCTGTGG - Intronic
1106180978 13:27369164-27369186 CTCACCCAACAGCGGCCATGGGG + Intergenic
1108856470 13:54799675-54799697 CAGCTCCACCTGCAGCCCTGTGG - Intergenic
1111976091 13:94968270-94968292 CATCCCCAGGAGAGGCCCTGCGG - Intergenic
1112033232 13:95475607-95475629 CACCCTCACCAGGGGCCCAGAGG - Intronic
1112065000 13:95783670-95783692 CACCACCACCTTTGGCCCTGTGG - Intronic
1112734407 13:102400719-102400741 CATCCCCACCCCTGGCCCTGTGG + Intronic
1113466951 13:110519705-110519727 CACTCCCACCAGGGTCTCTGGGG + Intergenic
1113698755 13:112366998-112367020 CACCCCCCCCAGCAGTCATGAGG + Intergenic
1113782743 13:112986025-112986047 CAGCCCCACGCACGGCCCTGGGG - Intronic
1114549643 14:23525517-23525539 CACCCCCACCTGAGGCCCTCGGG - Exonic
1114948360 14:27715715-27715737 CACTCCCATCACAGGCCCTGAGG + Intergenic
1114968978 14:28001899-28001921 CACCACCACCACAGGCCCTTAGG - Intergenic
1115610733 14:35046499-35046521 CACCAGCGCCAGCAGCCCTGTGG + Exonic
1119667433 14:76495163-76495185 CACCCCCACCTGAGGACCCGTGG + Intronic
1119753460 14:77097838-77097860 CACCCCCAACGGCGGCACGGCGG + Intergenic
1120030925 14:79639882-79639904 CACCCCCACCATCAGCCCCAAGG + Intronic
1122315095 14:100821229-100821251 CACCCCCACCCGGGGCCCCCTGG - Intergenic
1122540971 14:102497463-102497485 CACCTCCACCAGGGTCCCTGCGG - Intronic
1122711480 14:103661687-103661709 CACCACCACAATCGGCTCTGGGG - Intronic
1123004578 14:105315065-105315087 CACCCCCAGCAGGTGCCCGGCGG - Exonic
1123893236 15:24802411-24802433 CACCCTCAACAGCGCCCCTGTGG + Intergenic
1124214369 15:27794242-27794264 GACCCACACCAGGGCCCCTGTGG - Intronic
1125392354 15:39207680-39207702 CACTCCCATCACCGGCCCAGTGG + Intergenic
1125482599 15:40090873-40090895 CACCCCCAACATCGGCACTGAGG - Exonic
1125605300 15:40936840-40936862 CCCCCGCCCCAGGGGCCCTGGGG - Exonic
1126661688 15:51039025-51039047 CACCCCCACCCGCCCCGCTGTGG + Intergenic
1127534644 15:59878828-59878850 CCTCCCCACCAGCAGCCCTTTGG + Intergenic
1129129858 15:73483956-73483978 GACCCCCACCAACTCCCCTGGGG + Intronic
1129154316 15:73708351-73708373 CATTCCCCCCAGAGGCCCTGTGG + Exonic
1129191065 15:73937831-73937853 TACCCCCACCAGTGGTGCTGGGG + Intronic
1129243919 15:74268475-74268497 CACCCCCACCACCACCCCAGAGG - Intronic
1130149111 15:81297968-81297990 CACCCAGAGCAGAGGCCCTGTGG + Intronic
1130867697 15:87946575-87946597 TGCCACCACCAGCAGCCCTGAGG + Intronic
1131032383 15:89197083-89197105 CACACCCACCTGTGGCCCTGAGG - Exonic
1131264866 15:90910010-90910032 CACCCCCAACTGCAGCACTGTGG + Intronic
1132114343 15:99124800-99124822 CACCCCCAACACAGGGCCTGTGG - Intronic
1132405833 15:101541464-101541486 CAGCCCCACCAGGAGCCTTGGGG - Intergenic
1132571327 16:645670-645692 CACACCCTCCATCTGCCCTGGGG - Intronic
1132592850 16:733894-733916 GACCCCCACCTGAGGCCCAGCGG - Intronic
1132869798 16:2110876-2110898 CACCCGTGCCAGGGGCCCTGAGG - Exonic
1132976709 16:2714682-2714704 CAGCCCCACCTGCGGGCCTCTGG + Intronic
1133834314 16:9352380-9352402 AACCCCCAGCAGCTGCACTGTGG - Intergenic
1134446280 16:14333644-14333666 CACACCCACCCCCGCCCCTGTGG - Intergenic
1135879593 16:26241043-26241065 CACTGCCACCACAGGCCCTGGGG - Intergenic
1138002116 16:53292201-53292223 CACTCCCACCAGCATCCCAGAGG + Intronic
1138598604 16:58042225-58042247 CGCCAGAACCAGCGGCCCTGGGG - Exonic
1141551665 16:84810501-84810523 CACGCCCAACAGGGGACCTGGGG + Intergenic
1141720041 16:85750978-85751000 CACCACCACCAGCGCCCGGGCGG - Exonic
1142035678 16:87861061-87861083 CACGCTCCCCAGAGGCCCTGTGG - Intronic
1142282726 16:89156928-89156950 CCCACCCAACAGCGGCCCTTGGG + Intergenic
1142352613 16:89586996-89587018 CACCCCCGCCAGGGACACTGAGG - Intronic
1143020534 17:3915159-3915181 AGCCCCCTCCAGTGGCCCTGGGG + Intronic
1144658499 17:17053096-17053118 CCACCCCTCCCGCGGCCCTGAGG - Intronic
1146503924 17:33388250-33388272 TACCCCCTCCAGAGGCTCTGGGG - Intronic
1147015722 17:37489968-37489990 AACCCCCACCCCCGGGCCTGCGG - Intronic
1147155148 17:38540949-38540971 CACCGCCACCAGCCTCCCTGTGG - Intronic
1147880036 17:43647560-43647582 CACCCCTTCCAGAGGTCCTGGGG + Intronic
1148323179 17:46769682-46769704 CACCCCTTCCGGCAGCCCTGTGG - Intronic
1148347362 17:46912361-46912383 GACCCCTACCAGCAGCCCTGAGG - Intergenic
1149595617 17:57862897-57862919 GACCCCCACCAGAGGCTCTTTGG - Exonic
1150294651 17:64001423-64001445 GACCCCCATCAGAGGCCCAGGGG - Intronic
1150675649 17:67244758-67244780 CACCCCCAGCCGCGACCCGGAGG + Intronic
1152184365 17:78844791-78844813 CACCCCTTCCTGTGGCCCTGTGG + Intergenic
1152245927 17:79184524-79184546 CACACTCACCAGAGGCCCCGTGG + Intronic
1153123241 18:1757302-1757324 CAACCCCACAACCGGCCCCGCGG - Intergenic
1153975922 18:10268392-10268414 CACCCCCACAGGGGGCCTTGAGG - Intergenic
1155054151 18:22170368-22170390 CAGCCCCACCGGCGTCCCCGCGG - Intronic
1155157266 18:23168085-23168107 CCACCCCATCAGCTGCCCTGGGG - Intronic
1155362444 18:25016355-25016377 CAGCCCCAGCCGCAGCCCTGAGG + Intergenic
1158685533 18:59610844-59610866 CTGCTCCACCAGCGCCCCTGGGG + Intronic
1159431230 18:68356335-68356357 CACCTCCAGCAGCAGGCCTGGGG + Intergenic
1160454819 18:78992888-78992910 CAGCACCCCCGGCGGCCCTGCGG + Exonic
1160463885 18:79059517-79059539 GACCCCCAGCAGAAGCCCTGGGG - Intergenic
1160729967 19:637186-637208 CGCTCCCTCCAGAGGCCCTGGGG + Intergenic
1160762382 19:791995-792017 CACCCCCACCCTGGGCCCTCAGG - Intergenic
1160767152 19:813722-813744 CGCGCCCTCCAGCCGCCCTGGGG + Exonic
1160839697 19:1140594-1140616 CACCCCCACCCCCACCCCTGGGG - Intronic
1160930443 19:1567585-1567607 CGCCCCACCCCGCGGCCCTGGGG - Exonic
1162026123 19:7895086-7895108 CACCCCCTCCAGGGGCACTCTGG - Intronic
1163371887 19:16905773-16905795 TACCCCCAGCAGCTGCACTGGGG - Intronic
1163398344 19:17076758-17076780 CGGCCCCACAACCGGCCCTGAGG - Intronic
1163677211 19:18661076-18661098 CTCATCCTCCAGCGGCCCTGGGG + Intronic
1164616215 19:29668230-29668252 CCCCTCTACCAGCAGCCCTGGGG + Intronic
1164709147 19:30343066-30343088 CTCCCCCACCCTCGGCCCGGTGG + Intronic
1165324888 19:35108828-35108850 CAGCCACACCAGCCTCCCTGTGG - Intergenic
1166687459 19:44804134-44804156 CAGCACCCCCAGCCGCCCTGTGG - Intergenic
1166999847 19:46739269-46739291 CACCTCCACCAGCAGCCTTAGGG - Intronic
1167062409 19:47157875-47157897 CAGCCTCACCAAGGGCCCTGCGG + Intronic
1167376457 19:49114670-49114692 GACTGCCACCAGCGGCCCTGCGG - Intronic
1167459397 19:49616236-49616258 CACCCACCCCTGCAGCCCTGAGG - Intronic
1168020571 19:53606163-53606185 CGCCCACACCAGCACCCCTGTGG - Intergenic
926753959 2:16221375-16221397 CACCACCAGCAGAGGCCCTCAGG + Intergenic
927641036 2:24845778-24845800 CCCTCCCACCACAGGCCCTGAGG + Intronic
927709032 2:25313954-25313976 CATGCCCTCCAGCGGCCCCGGGG - Exonic
928138472 2:28706952-28706974 CACTCCCCCCAGAGGCTCTGGGG - Intergenic
928270262 2:29849178-29849200 CTTCCCCACCAGCTGCTCTGGGG + Intronic
928735357 2:34282494-34282516 CACCCACACCAGCAGCACAGTGG + Intergenic
929005295 2:37387662-37387684 CTTCCCCAGCAGCTGCCCTGGGG + Intergenic
930972158 2:57408867-57408889 CACCACCACCACAGGCCCAGGGG - Intergenic
933461785 2:82597137-82597159 CATCCCCACCATCAGCCCTATGG - Intergenic
933833198 2:86226756-86226778 CACCCCGCCCAGTGACCCTGTGG + Intronic
934058872 2:88275618-88275640 ACCCCCCACCACAGGCCCTGGGG + Intergenic
934860360 2:97759472-97759494 CATCCACACCAGCAGCCCAGAGG - Intronic
936450623 2:112631210-112631232 CACCTCCTCCAGGGGCACTGGGG + Intergenic
936462417 2:112722980-112723002 CAACCCCACCAGCCACACTGGGG - Intronic
936743494 2:115544789-115544811 CACCACCACCAGCAGCAGTGAGG - Intronic
936886684 2:117318874-117318896 CATACCCAGCAGAGGCCCTGGGG - Intergenic
937235797 2:120431224-120431246 CACTCCCACCACCGTCCCTGTGG - Intergenic
938097478 2:128473131-128473153 CACCCCCACCCTGGGTCCTGCGG - Intergenic
944892951 2:204136236-204136258 CACCCCCACCAACCCCCATGAGG - Intergenic
947418561 2:229921946-229921968 CACCCCCCCCAGCGGCGCGGCGG + Exonic
948663580 2:239521177-239521199 CACACCCTCCAGGGTCCCTGTGG - Intergenic
1169207969 20:3750501-3750523 CACCCCCACCCCGGGCCCTGCGG + Intronic
1171114119 20:22509578-22509600 CACCCGCACCTGTGGCCATGTGG + Intergenic
1171899035 20:30839987-30840009 CCCCCCCATCACAGGCCCTGAGG + Intergenic
1172619618 20:36310353-36310375 CTCCACCACCAGCCTCCCTGTGG - Intronic
1172997747 20:39083517-39083539 CACCCCCACCAGTAGCCCCCTGG - Intergenic
1173831585 20:46092271-46092293 CAGCTCCACCTGCGGCCCAGTGG + Intergenic
1175773340 20:61637332-61637354 CTCCCCTACCCGCAGCCCTGAGG + Intronic
1175928905 20:62484426-62484448 CACCCTCTCCAGAGGACCTGGGG - Intergenic
1175930541 20:62491867-62491889 CACCCCCACCAGGCTCCCAGGGG + Intergenic
1176048525 20:63104779-63104801 CATGCCCACGAGCTGCCCTGGGG + Intergenic
1176077409 20:63254630-63254652 CACCCCCGCCTGCGGCCCCTGGG + Intronic
1176180633 20:63747821-63747843 CACCCCCACCAGAGGCCCCCTGG + Intronic
1176219463 20:63963207-63963229 CAGTACCACCAGCGGCGCTGCGG - Exonic
1178015885 21:28345761-28345783 CACCCCCACCCCCGGCCCAATGG + Intergenic
1178872032 21:36385322-36385344 CCGCCCCTCCAGCGGCCCTCAGG - Intronic
1179057870 21:37952688-37952710 CACCCACACCAGCGGTGCAGGGG + Intronic
1179826774 21:43970602-43970624 CACCCACCCCAGCTGCTCTGTGG + Intronic
1179905718 21:44421975-44421997 CACACCAGCCAGCGGCCCAGCGG - Intronic
1180079823 21:45481556-45481578 CACCGTCACCATCGGCTCTGAGG + Intronic
1180138769 21:45878210-45878232 CTCTCCCACCAGAGGACCTGTGG + Intronic
1180869745 22:19139413-19139435 GACCCTCTCCAGCGGCACTGGGG - Intronic
1181038508 22:20181282-20181304 CACCCCCAGCACAGGCACTGGGG - Intergenic
1181468268 22:23122422-23122444 CACTCCCACCAGCTGCTGTGGGG - Intronic
1181577590 22:23805203-23805225 CCCCCTCACCAGCTGACCTGTGG - Intronic
1181680831 22:24494941-24494963 CACCCGCGCCAGGGCCCCTGAGG + Intronic
1182332647 22:29561852-29561874 CACCCCCAACAGTGCACCTGTGG - Exonic
1183281886 22:36936606-36936628 CCCCCACACCAGGGGCCGTGGGG + Exonic
1183705827 22:39474410-39474432 CACACCCACCTGCGGCCTTGGGG - Intronic
1184241328 22:43212633-43212655 CACCCACAGCCTCGGCCCTGCGG - Intronic
1184415177 22:44348013-44348035 GACCCCCACCAGGGGACTTGAGG + Intergenic
1184734260 22:46388827-46388849 CACTCCCACCCGCAGCTCTGAGG - Intronic
1184770716 22:46595092-46595114 CAGCCCCACATGCGGCCCGGGGG + Intronic
1185012086 22:48319862-48319884 CACTCCCGCCAGCTTCCCTGAGG - Intergenic
1185165940 22:49262304-49262326 AACCCCCGACAGCGGCCCTGGGG + Intergenic
1185236419 22:49716209-49716231 CATCCGCACCATCTGCCCTGAGG + Intergenic
1185271618 22:49932111-49932133 CACCACCACCAGACGGCCTGTGG - Intergenic
1185339333 22:50284515-50284537 CCACCCCACCCGGGGCCCTGGGG + Intronic
949939017 3:9139546-9139568 CACTCCCTCCAGCGGCTCTAGGG - Intronic
950215177 3:11154131-11154153 CACCCCCACCCACGCACCTGCGG - Intronic
950547419 3:13646607-13646629 CACCCACACCATTGTCCCTGGGG + Intergenic
954025856 3:47782313-47782335 CTCCACCCCCAGCGGCCCGGCGG + Intergenic
954306109 3:49726340-49726362 CAGAGCCACCAGAGGCCCTGAGG + Exonic
954856996 3:53652657-53652679 CACTACTACCAGTGGCCCTGTGG - Intronic
955503976 3:59612981-59613003 CCCCCCCACCAGGGGTCCTTGGG + Intergenic
956214092 3:66830519-66830541 CAACTCCACCAGCAGCCATGAGG + Intergenic
956787117 3:72651965-72651987 CACCACCACCATCAGCACTGTGG + Intergenic
957080499 3:75632254-75632276 CTCCTCCACATGCGGCCCTGAGG - Intergenic
957121599 3:76101712-76101734 CAACCCCACAAGAGGCCCTGGGG + Intronic
960057691 3:113286810-113286832 CACACGCACCAGTGGCCCCGGGG - Exonic
961733365 3:128984060-128984082 CACCCCCACCTGGTGCCCAGTGG - Intronic
961823713 3:129588050-129588072 CACACCCAGCACAGGCCCTGGGG - Intronic
964307988 3:155361437-155361459 CACCCCCAGCTGCTGCCATGGGG - Intergenic
964583021 3:158260918-158260940 AACCCCCAGCAGCAGCCATGTGG - Intronic
964717011 3:159732961-159732983 CACCCCCACCTCCTGCTCTGTGG - Intronic
968067117 3:195764831-195764853 CATCCCCACCAGCGGACATTCGG - Intronic
968429104 4:544823-544845 CACCACCACCACGGGCCCTGGGG + Intergenic
968490094 4:885502-885524 CACCCACCCCAGCAGCCCTGCGG + Intronic
968661504 4:1800639-1800661 CACGCCCATCAGGGGCACTGAGG - Intronic
969564646 4:7970773-7970795 CTCCATCACCAGAGGCCCTGGGG + Intronic
969595132 4:8144388-8144410 GTCCCCCAGCGGCGGCCCTGGGG - Intronic
971351810 4:25862610-25862632 CGCCCCCACCCGCGTCCCCGGGG + Intronic
973546114 4:51983520-51983542 CAACCCCACAACAGGCCCTGGGG + Intergenic
974593687 4:63988808-63988830 CCCCCCCACCACCAGCCATGTGG + Intergenic
974624038 4:64399539-64399561 CCCTCCCACCAGAAGCCCTGAGG + Intronic
975439878 4:74399015-74399037 CAGCTCCACCTGCGGCCCGGTGG - Intergenic
975580954 4:75906578-75906600 CACCCCTAGAAGCTGCCCTGGGG + Intergenic
977338659 4:95729873-95729895 TACCCCCAGCAGCATCCCTGTGG + Intergenic
978008782 4:103652429-103652451 CATCCCCAGCAGCAGCCATGTGG - Intronic
979205629 4:118033831-118033853 CACCCGGACGAGGGGCCCTGGGG + Intronic
981558720 4:146023867-146023889 CAGCCCCAGCAGTGGCCATGTGG - Intergenic
981975609 4:150723930-150723952 CACCCCCACCACCGGTCCACAGG - Intronic
984788511 4:183592102-183592124 CACCACCCCCAGTGGCCCTCAGG + Intergenic
984915369 4:184718604-184718626 CACTCTCACCAGCGTTCCTGCGG - Intronic
985210380 4:187586497-187586519 CACCACCACCAGCAGCCGTGGGG - Intergenic
985641526 5:1065558-1065580 CACCCGCACCACCTCCCCTGTGG + Intronic
993696124 5:91063835-91063857 CACCACCACCAGCTCCCCTATGG - Intronic
997297380 5:132776779-132776801 GACCCTCACCTGCGGCCCCGCGG + Intronic
997438214 5:133890321-133890343 CACCCCAAGCAGCGGCCATGTGG + Intergenic
998114101 5:139523558-139523580 CAACCCAACCAGCGGGGCTGAGG - Intergenic
999970094 5:156850519-156850541 CACGCCAAGCAGCGACCCTGAGG + Intergenic
1000159816 5:158586629-158586651 CACCACCACCACAGGCCATGGGG + Intergenic
1000159976 5:158587608-158587630 AACCCCCAGCAGCAGCTCTGTGG - Intergenic
1002428109 5:179187596-179187618 CCCTCCCCCCAGCAGCCCTGGGG + Intronic
1002577088 5:180180100-180180122 CACATCCACCAGCAGCTCTGGGG + Intronic
1003017675 6:2481092-2481114 GACCCCCACAAGTGACCCTGAGG - Intergenic
1003402528 6:5802734-5802756 CAAGCCCACCAGGGCCCCTGTGG + Intergenic
1005854906 6:29853219-29853241 CTCCCCAAGCAGCAGCCCTGGGG - Intergenic
1005982119 6:30844494-30844516 CACACCCACCAGCCACACTGTGG + Intergenic
1006008382 6:31021130-31021152 CAGCTCCACCTGCGGCCCCGGGG + Intronic
1006067902 6:31475540-31475562 CTCCACCACCAGTGGCGCTGTGG - Intergenic
1006155533 6:32011074-32011096 CCCACCCTCCAGCCGCCCTGGGG - Intergenic
1006161865 6:32043928-32043950 CCCACCCTCCAGCTGCCCTGGGG - Intronic
1006645343 6:35511614-35511636 CCCCCTCACCCGCGTCCCTGGGG + Intronic
1006717672 6:36130708-36130730 CCCGCCCCCCAGCGGCCCAGGGG - Intronic
1006750402 6:36373307-36373329 CACCCCCACCTCCTGCTCTGGGG - Intronic
1006803146 6:36772025-36772047 CACCTCCTCCAACGGCCCAGTGG + Intronic
1007605361 6:43114036-43114058 CACCCGCCCCAGCAGCCCTGGGG - Intronic
1007767748 6:44171010-44171032 CGGCCACAGCAGCGGCCCTGGGG - Intronic
1010528776 6:76941316-76941338 CTACCCCAGCAGTGGCCCTGTGG + Intergenic
1011226350 6:85111712-85111734 CCCCCCCATCCCCGGCCCTGGGG - Intergenic
1011815197 6:91181449-91181471 CACCTGCAACAGCTGCCCTGGGG - Intergenic
1015746128 6:136511670-136511692 CACTCCCACCTGCTGCTCTGTGG - Intronic
1017727394 6:157284994-157285016 TTCACCCACCAGTGGCCCTGGGG + Intergenic
1017900571 6:158715649-158715671 CACCCCCACCCCCTGCCCAGAGG + Intronic
1018908693 6:168089634-168089656 CACCCCTTCCAGCAGCACTGGGG + Intergenic
1018977910 6:168579606-168579628 CACCCTCACCAGCTCCCCTCAGG - Intronic
1019095340 6:169575097-169575119 CACCACCACCAGCTATCCTGGGG + Intronic
1019606009 7:1910589-1910611 CACCCCCACCAGTGGTCTTCTGG + Intronic
1020111723 7:5451528-5451550 CAGCCCCATAAACGGCCCTGCGG + Intronic
1020430723 7:8113869-8113891 CGCCCCCAGCAGCTCCCCTGGGG - Exonic
1020481640 7:8669151-8669173 CACCCACACCAGCAGACCCGAGG - Intronic
1021600151 7:22356746-22356768 CGCCCCCCTCAGCGGCCCGGGGG + Intronic
1023584636 7:41716525-41716547 CACCTCCACCACCGTCCCTCAGG + Intergenic
1023631776 7:42172260-42172282 CACCCCCACCCTCTGCCCTTTGG - Intronic
1023722636 7:43112479-43112501 CACCCCCACCCCCGCCCCCGCGG - Intergenic
1024020229 7:45361909-45361931 CACGCCCCACAGTGGCCCTGTGG - Intergenic
1024946392 7:54811948-54811970 CACGAGCAGCAGCGGCCCTGTGG - Intergenic
1028307859 7:89289499-89289521 CACCCCTAGCAGCAGCCATGTGG + Intronic
1031657724 7:124379400-124379422 CACCCCCAGCAGAGGCTGTGTGG + Intergenic
1034564772 7:151904387-151904409 CACCCTGACCCGGGGCCCTGTGG + Intergenic
1034996153 7:155578364-155578386 GACCCCCACCAGCAGCCCTCAGG + Intergenic
1040285655 8:46099205-46099227 CACCCTCACCAGCCTGCCTGTGG - Intergenic
1042898260 8:73694746-73694768 CACTCCCAGCAGCAGCCATGTGG + Intronic
1045438865 8:102190527-102190549 CACCCCCACCTGTGTCTCTGTGG + Intergenic
1046054108 8:109058976-109058998 CAGCCCCAGCAGAGGCCGTGTGG - Intergenic
1048576395 8:135693534-135693556 CAACCCCACCAGGAGCTCTGAGG + Intergenic
1049418758 8:142507551-142507573 CACCCACAGCAGGAGCCCTGGGG + Intronic
1049422475 8:142523095-142523117 CACCCCCCACAGCAGGCCTGTGG + Intronic
1049573201 8:143379065-143379087 CGCCCTCACCAGCGGCCCTCTGG - Exonic
1049725133 8:144142290-144142312 CACCCTTACCCTCGGCCCTGAGG - Intergenic
1049812668 8:144582447-144582469 CGGCCCCAGCAGCAGCCCTGGGG + Intronic
1049989229 9:976568-976590 CACCGCCACCCCCGCCCCTGGGG - Intergenic
1050388145 9:5111655-5111677 CCCGCCCAGCAGCGGCCCTGTGG + Intronic
1050547954 9:6724964-6724986 CACTCCCTCCAGAGGCTCTGGGG + Intronic
1050678952 9:8087566-8087588 CAACCCCACAACAGGCCCTGGGG - Intergenic
1053296041 9:36913507-36913529 CTCCCCCATCAGCAGGCCTGTGG + Intronic
1053392569 9:37746271-37746293 CACCCCTGCCAGCACCCCTGAGG + Exonic
1056446073 9:86667208-86667230 CACCCCAACCAACCACCCTGCGG - Intergenic
1058780210 9:108325569-108325591 CACTCCCACCTGAGGCCATGAGG - Intergenic
1058950956 9:109903325-109903347 CAACCCAACCAGTGGCCCTGTGG - Intronic
1060803797 9:126562465-126562487 CACGCCCACCAGGGGTTCTGGGG - Intergenic
1061716726 9:132522888-132522910 CACCCTCACCACCGGCCACGCGG + Intronic
1061791961 9:133063711-133063733 CACCCCCACGAGGGGCCTGGAGG - Intronic
1061922115 9:133788036-133788058 CACCCTCACTAGAGGCCTTGGGG + Intronic
1061974046 9:134059528-134059550 CACCCCTCGCAGCTGCCCTGCGG + Intronic
1061987007 9:134135771-134135793 CACAGACACCAGCGGCCCTCCGG - Intronic
1062320588 9:135988842-135988864 CACCTCCCCCAGGGGCCCAGAGG - Intergenic
1062418229 9:136464811-136464833 CACCCTCATGAGCCGCCCTGAGG + Intronic
1185726729 X:2427549-2427571 GACTCCCACCAGCACCCCTGTGG - Intronic
1190530430 X:51369025-51369047 CACCACCACCCCCGGCCATGAGG - Intergenic
1190732278 X:53234042-53234064 CACCCCCAGCAGTTGCCATGGGG - Exonic
1192208985 X:69115356-69115378 AACCCCCAACAGCGGCCCTAAGG + Intergenic
1192435046 X:71137867-71137889 CACCTGCAACAGCGGCCCAGTGG + Exonic
1192962548 X:76145502-76145524 CACCCCCACCGGCTGCCCGGTGG + Intergenic
1192962985 X:76149585-76149607 CACCCCCACCGGCTGCCCGGTGG - Intergenic
1193984968 X:88229114-88229136 CACCACCACCATAGGCCATGAGG - Intergenic
1194348335 X:92793896-92793918 CACCCCCACCACAGGCCATGGGG - Intergenic
1196168958 X:112565938-112565960 CCCTCCCATCAGAGGCCCTGAGG - Intergenic
1197438019 X:126456313-126456335 CACTACCACCAGAGGCCATGAGG - Intergenic
1197648064 X:129038648-129038670 CACCCCCAAAAGAGTCCCTGGGG + Intergenic
1198694917 X:139325319-139325341 CACCCCCACCTCAGGCCATGAGG - Intergenic
1199156178 X:144551390-144551412 CACCACCACCACAGGCCATGAGG - Intergenic
1200088648 X:153624256-153624278 CTGCCCAGCCAGCGGCCCTGGGG - Intergenic
1200094139 X:153649436-153649458 CACCCCCACCAGTGGGGCTGCGG + Exonic
1200216812 X:154371702-154371724 CACCCCCCGCAGGGGCCCTGGGG - Intronic
1200656662 Y:5910524-5910546 CACCCCCACCACAGGCCATGGGG - Intergenic