ID: 1076701446

View in Genome Browser
Species Human (GRCh38)
Location 10:132275274-132275296
Sequence CCAGCACCCACCCCCACCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701446_1076701458 21 Left 1076701446 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
Right 1076701458 10:132275318-132275340 GTCAGCAACAGTAGCAAGGCTGG No data
1076701446_1076701459 25 Left 1076701446 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
Right 1076701459 10:132275322-132275344 GCAACAGTAGCAAGGCTGGCAGG No data
1076701446_1076701452 -5 Left 1076701446 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
Right 1076701452 10:132275292-132275314 GCTGGGACCCCCGGGGAAGATGG No data
1076701446_1076701457 17 Left 1076701446 10:132275274-132275296 CCGCTGGTGGGGGTGGGTGCTGG No data
Right 1076701457 10:132275314-132275336 GTGAGTCAGCAACAGTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076701446 Original CRISPR CCAGCACCCACCCCCACCAG CGG (reversed) Intronic
No off target data available for this crispr