ID: 1076701450

View in Genome Browser
Species Human (GRCh38)
Location 10:132275284-132275306
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076701429_1076701450 27 Left 1076701429 10:132275234-132275256 CCACCAGGCCCCATGGCTACTCA 0: 1
1: 0
2: 1
3: 29
4: 370
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701442_1076701450 -4 Left 1076701442 10:132275265-132275287 CCCACAGGGCCGCTGGTGGGGGT 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701430_1076701450 24 Left 1076701430 10:132275237-132275259 CCAGGCCCCATGGCTACTCACAG 0: 1
1: 0
2: 2
3: 23
4: 220
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701433_1076701450 17 Left 1076701433 10:132275244-132275266 CCATGGCTACTCACAGACAGCCC 0: 1
1: 1
2: 1
3: 15
4: 163
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701427_1076701450 29 Left 1076701427 10:132275232-132275254 CCCCACCAGGCCCCATGGCTACT 0: 1
1: 0
2: 2
3: 36
4: 369
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701431_1076701450 19 Left 1076701431 10:132275242-132275264 CCCCATGGCTACTCACAGACAGC 0: 1
1: 0
2: 0
3: 17
4: 159
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701443_1076701450 -5 Left 1076701443 10:132275266-132275288 CCACAGGGCCGCTGGTGGGGGTG 0: 1
1: 0
2: 1
3: 42
4: 323
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701432_1076701450 18 Left 1076701432 10:132275243-132275265 CCCATGGCTACTCACAGACAGCC 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701428_1076701450 28 Left 1076701428 10:132275233-132275255 CCCACCAGGCCCCATGGCTACTC No data
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data
1076701440_1076701450 -3 Left 1076701440 10:132275264-132275286 CCCCACAGGGCCGCTGGTGGGGG 0: 1
1: 0
2: 1
3: 30
4: 294
Right 1076701450 10:132275284-132275306 GGGTGGGTGCTGGGACCCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr