ID: 1076703791

View in Genome Browser
Species Human (GRCh38)
Location 10:132290165-132290187
Sequence CCCAGCCCTGCTCTCCTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 590
Summary {0: 1, 1: 0, 2: 7, 3: 71, 4: 511}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076703791_1076703799 17 Left 1076703791 10:132290165-132290187 CCAGAAAGGAGAGCAGGGCTGGG 0: 1
1: 0
2: 7
3: 71
4: 511
Right 1076703799 10:132290205-132290227 ACACCGCAGTACACTCCCTAAGG No data
1076703791_1076703793 -6 Left 1076703791 10:132290165-132290187 CCAGAAAGGAGAGCAGGGCTGGG 0: 1
1: 0
2: 7
3: 71
4: 511
Right 1076703793 10:132290182-132290204 GCTGGGCCATGCCTCCCCGCTGG No data
1076703791_1076703800 18 Left 1076703791 10:132290165-132290187 CCAGAAAGGAGAGCAGGGCTGGG 0: 1
1: 0
2: 7
3: 71
4: 511
Right 1076703800 10:132290206-132290228 CACCGCAGTACACTCCCTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076703791 Original CRISPR CCCAGCCCTGCTCTCCTTTC TGG (reversed) Intronic
900124580 1:1063827-1063849 CCCATCCCTGCCCTCCTGGCTGG + Intergenic
900514715 1:3076106-3076128 ACCAGCCCCGCGCTCCTCTCAGG + Intronic
900520705 1:3104285-3104307 CCAAGACCTGCTGTCCTTGCTGG + Intronic
900573541 1:3371789-3371811 CCCAGCCCATCTGCCCTTTCTGG + Intronic
900793047 1:4692056-4692078 CTCAGCCCTGTGCTCCTTCCGGG + Intronic
901672619 1:10865105-10865127 CCCCTCCCTGCTCCCCTTGCAGG - Intergenic
901701439 1:11046770-11046792 CCCAGGCCTGATCTCCCTCCTGG + Intronic
901713147 1:11131383-11131405 CCCAGTGCAGCTCTGCTTTCTGG - Intronic
902241925 1:15095215-15095237 CCCAGCACTCCTCTGCCTTCCGG + Intronic
902376192 1:16031032-16031054 CCCACTCCTGCTGTCCTTGCTGG + Intronic
902381120 1:16052758-16052780 CCCACTCCTGCTGTCCTTGCTGG + Intronic
902758304 1:18564060-18564082 CCCGCCCTTGCTCTCCTCTCTGG - Intergenic
902805884 1:18861150-18861172 CCAAGCCCTGCTCCTCCTTCAGG + Intronic
902875183 1:19336699-19336721 CTCAGGCCCGCTCTCCTCTCAGG - Intergenic
902955397 1:19921672-19921694 CCAGGCCCTGCCCTTCTTTCAGG + Intronic
903065785 1:20698471-20698493 CCCAGCCCTGCTGTCCAGGCAGG - Exonic
903183045 1:21614719-21614741 GCCAGCCCTGGGCTCCTCTCTGG - Intronic
903772039 1:25770133-25770155 CCCAGCCCTTCTCTTCTGTGGGG + Intronic
904275400 1:29380663-29380685 TCCAGCTCTCCTCTCCTTCCTGG + Intergenic
904359272 1:29961524-29961546 CCCAGAAGTGCTCCCCTTTCAGG - Intergenic
904371565 1:30050770-30050792 CTCAGCCATGCTCTCCCTTCTGG - Intergenic
904493469 1:30874189-30874211 CCACGCCCTGATCTCCTTTCTGG + Intronic
904603062 1:31684135-31684157 CGGGGCCCTGCTCTCCTTTGGGG + Exonic
904641921 1:31937861-31937883 CCCGGCCCGGCCCTCCTTCCGGG + Intronic
904810174 1:33158368-33158390 CCCTTTCCTGCTCTCCTTCCAGG - Exonic
905474497 1:38216552-38216574 CACAGCCCCGCTCTCCTTCAGGG - Intergenic
906296188 1:44650457-44650479 CCCAGCCTTGTTCTCATTACTGG + Intronic
906776891 1:48537924-48537946 CCCAGCACTTCCCTCCTGTCAGG + Intronic
907045251 1:51296648-51296670 CCAGGCCCTGCTCACGTTTCTGG - Intronic
907911058 1:58826370-58826392 CCCTACCTTGCTTTCCTTTCAGG + Intergenic
908426996 1:64017217-64017239 CAAATCCCTGCTCTCCTATCAGG - Intronic
909003439 1:70246450-70246472 CCCAACCCACCTCTCCTATCAGG - Intronic
910453618 1:87372395-87372417 CCCAGTCCTCCTGCCCTTTCTGG + Intergenic
910842151 1:91571079-91571101 GCCAGCCCTGGGCTCCTTTTGGG - Intergenic
912570955 1:110620528-110620550 CCCTGCCCAGCCCTCCTCTCTGG - Intronic
913099034 1:115546146-115546168 CCCAGCCCTGTGCTCCTTCCCGG - Intergenic
913120959 1:115740365-115740387 CCCATCCCTCCTCTCTCTTCAGG + Intronic
913999400 1:143680010-143680032 CCCACAGCTTCTCTCCTTTCAGG - Intergenic
914194504 1:145438614-145438636 CCCACAGCTTCTCTCCTTTCGGG - Intergenic
914475834 1:148021496-148021518 CCCACAGCTTCTCTCCTTTCGGG - Intergenic
915146957 1:153801038-153801060 CCCTTCCCTGCTCTCCTTGGAGG + Intergenic
915586228 1:156845357-156845379 CCTAGTCCTGCTCACCTTTGGGG + Exonic
916060604 1:161096089-161096111 CCAGTCCCTGCTCTCATTTCTGG + Intergenic
916845984 1:168650527-168650549 CCTTGCCCTACTCTCCTTTGTGG + Intergenic
917581113 1:176378895-176378917 TCCAGTCCTGCTCTCCTCTCTGG + Intergenic
917666657 1:177231631-177231653 ACCTACCCAGCTCTCCTTTCAGG + Intronic
917678924 1:177346728-177346750 CCCAGCCCCGCACGCCTTTCTGG - Intergenic
917981368 1:180271716-180271738 CCCAGACCTGTGCTCCATTCAGG + Intronic
919501265 1:198340989-198341011 CCCAGCCCAGCTCACCGTTCAGG - Intergenic
919786766 1:201263086-201263108 CCCAGCCCTGCCCTCCTGACTGG + Intergenic
919918931 1:202156811-202156833 CCCTCCCCTGCTCTCCCTACAGG - Intronic
919924496 1:202185417-202185439 CCCCTCCCTGCCCACCTTTCTGG - Intergenic
919991349 1:202710139-202710161 CCCAACCCTACTCACCTCTCGGG + Intronic
920820820 1:209379158-209379180 CACAGCCCTGCCCTCCTTGTAGG + Intergenic
922053869 1:222021706-222021728 CTCAGCTCTCCTCTGCTTTCTGG + Intergenic
922703494 1:227776103-227776125 CCCAGGGCTGCTCCCCTTCCTGG + Intronic
922753009 1:228079736-228079758 CCCAGCCCTGCCCTCCCTCTTGG - Intergenic
922899102 1:229122667-229122689 CTCAGACATGATCTCCTTTCTGG - Intergenic
924657275 1:245984295-245984317 CCCAACCCTACTCTCATCTCAGG + Intronic
1062950137 10:1492808-1492830 CAAAGCCCTGCTCTCCCTCCTGG - Intronic
1063198209 10:3762745-3762767 CACAGCACAGCTGTCCTTTCTGG + Intergenic
1063924665 10:10966092-10966114 TCCATCCCTGTTCTCCTATCTGG - Intergenic
1064153807 10:12887215-12887237 CCCAGCCCTACTTTCTTATCTGG - Intergenic
1064416417 10:15154088-15154110 GCCAGCCCTGCTGTCATTTTAGG - Intronic
1065694822 10:28370151-28370173 CACAGCACTGCACTCCCTTCTGG + Intergenic
1065948030 10:30625112-30625134 CACAGGCCTGTTTTCCTTTCTGG - Intronic
1068943013 10:62699359-62699381 CCCAGCCCCTATCTTCTTTCAGG - Intergenic
1069275468 10:66586400-66586422 GCCACCCCAGCTCTCCTTCCAGG + Intronic
1069593283 10:69654998-69655020 CCCAGCTCTGCCCTCCTTCCAGG - Intergenic
1069817916 10:71210273-71210295 CCGGGCCCTGCTCTCCCTCCAGG - Intergenic
1070750015 10:78958507-78958529 CCCAGCCCTGCCTGCCTCTCTGG + Intergenic
1071109788 10:82142437-82142459 CCCAGCCCTTATCCCCTCTCTGG - Intronic
1071570720 10:86695340-86695362 CACAGCCCTCTTCTCCTCTCGGG + Intronic
1071589800 10:86862186-86862208 CCTAGCACTCCTCTCCTTTCTGG - Intronic
1074153355 10:110778145-110778167 TACAGCCCTGTTCTCCTTTGGGG - Intronic
1074408557 10:113202230-113202252 CACAGCACTGCTTTCCCTTCAGG - Intergenic
1075588803 10:123676828-123676850 CACAACACTGCACTCCTTTCTGG - Intronic
1075651463 10:124130327-124130349 CACAGCCCTGCCTTCCCTTCTGG - Intergenic
1075953107 10:126498878-126498900 CCCAGTCCTGCTTCCCTTCCTGG + Intronic
1076271151 10:129153193-129153215 TCCAGCCCTCCTCTCCTTGCTGG - Intergenic
1076408359 10:130229033-130229055 CCCAGGGCTGCTTTCCTGTCTGG - Intergenic
1076523484 10:131095311-131095333 CCCAGCCCTGCCCGCCTCTCGGG - Intronic
1076703791 10:132290165-132290187 CCCAGCCCTGCTCTCCTTTCTGG - Intronic
1076793673 10:132788870-132788892 CCTAGGCCGGCTCTCCTTCCGGG - Intergenic
1077027927 11:449994-450016 CCCAGCCCCGTTCTCCTTTTGGG - Intronic
1077110962 11:862082-862104 CCCAGCCCTGCCCTCACTCCGGG - Intronic
1077282436 11:1751756-1751778 CCCAGCTCTGCTCAGATTTCAGG + Intronic
1077308618 11:1878737-1878759 CCCAGCCCTGCTCCCTGTTCTGG + Intronic
1077375581 11:2203887-2203909 CCCAGGCCTGCTCTCCTCAGGGG - Intergenic
1077413375 11:2413700-2413722 CCCAGCCCAGCCCTCCCTCCCGG + Intronic
1077421371 11:2451675-2451697 CCCAGCCCGGCTCTTCCATCAGG - Intronic
1078135185 11:8646001-8646023 CTCTGCCCTGCTGTCCTCTCAGG - Intronic
1079414229 11:20218138-20218160 CCCACCCCTTATCTCCTTTCTGG + Intergenic
1080052335 11:27870142-27870164 CACAGACTTGCTCTCCCTTCAGG - Intergenic
1081470838 11:43368993-43369015 CTCAGCCTCTCTCTCCTTTCAGG + Intronic
1081742447 11:45449994-45450016 CTGAGCCCTGCTCCCCCTTCTGG + Intergenic
1082812515 11:57487094-57487116 CCCAGAAGGGCTCTCCTTTCAGG + Exonic
1083025202 11:59544979-59545001 CCCAGCCCTTGTCGTCTTTCTGG - Intergenic
1083250619 11:61464230-61464252 CCCTGCCCTGCTCTTCTTATAGG + Intronic
1083266219 11:61548124-61548146 CCCAGGAATGCTCCCCTTTCAGG - Intronic
1083292953 11:61699912-61699934 CCCAGCCCCACCCTCCTTCCAGG - Intronic
1083655849 11:64229296-64229318 GCCAGCACTGGTCTCATTTCGGG - Exonic
1083744900 11:64729983-64730005 CCCGGCCCCGCCCTCCCTTCTGG - Intronic
1083766168 11:64842627-64842649 CCCAGCCCTGCCTCCCTGTCTGG + Intronic
1083804675 11:65066739-65066761 CCCAGCCCAGCTCTCCTAGAGGG - Intronic
1084289362 11:68151916-68151938 CCCAGCCCTGCTGTCTTCTGTGG + Intergenic
1084400916 11:68942438-68942460 CCCTGCCATGTGCTCCTTTCCGG + Intergenic
1084559198 11:69893177-69893199 CCCAGCCCTGCTTCCCTTCAGGG - Intergenic
1084717644 11:70883785-70883807 CCCAGCCCTGCCTGGCTTTCAGG - Intronic
1084893989 11:72251923-72251945 GCCAGCCCTCCTCTCCTCTGGGG + Intergenic
1084933486 11:72574893-72574915 CCCAGCCCAGCCCTCCTTTGAGG - Intergenic
1084948494 11:72651900-72651922 CCCAGCTCTTCCCTCTTTTCAGG - Intronic
1085479062 11:76806734-76806756 CCCTGCCCTGCTGTCCTCACAGG - Intergenic
1085783273 11:79428722-79428744 CCCACCCCTGCCCTCGTTTTTGG - Intronic
1086266139 11:85000743-85000765 CCTAGCTCTGCTCTCCTCTGTGG + Intronic
1088322716 11:108570051-108570073 CTCAGATCTGCTTTCCTTTCTGG - Intronic
1088410297 11:109526480-109526502 CCCAGCCGTGCTTTCTTTTCAGG + Intergenic
1088593665 11:111423882-111423904 CCGAGGCCTGAGCTCCTTTCAGG + Intronic
1088714335 11:112535747-112535769 CTCAGCTCTGCTCTCTTTCCTGG + Intergenic
1088826985 11:113504204-113504226 CCCACCACTGCTCACCTGTCAGG - Intergenic
1089207281 11:116774645-116774667 CCCCAGCCTGCTTTCCTTTCTGG - Intergenic
1089252682 11:117176445-117176467 CCCAGCCCTGCCCAACTATCTGG - Intronic
1090224596 11:125062672-125062694 GTCACTCCTGCTCTCCTTTCTGG - Intergenic
1091297674 11:134485455-134485477 CCCAGGCCTGCTCTGCTTCCCGG - Intergenic
1091341092 11:134814600-134814622 CCCAGCCCTTGTCCCCTCTCTGG - Intergenic
1091403155 12:193113-193135 GCCTTCCCTGCTCTTCTTTCTGG - Intronic
1092056785 12:5514049-5514071 CCCAACCCTTCTCTCTTTCCTGG + Intronic
1092214658 12:6672536-6672558 CCCTTCCCTCCTCTCCTCTCCGG - Intronic
1093445269 12:19249947-19249969 CTCAGCACTGCTGACCTTTCTGG + Intronic
1094670137 12:32562222-32562244 CACAGGCCTCCTCTCCTTGCAGG - Intronic
1095174206 12:39071954-39071976 CCCTGCCCTGCTTTCCTTCTTGG - Intergenic
1096023912 12:48344949-48344971 TCCAGCCCAGCTGGCCTTTCTGG + Intronic
1096805238 12:54136719-54136741 CCTAACTCTGCACTCCTTTCTGG - Intergenic
1097026094 12:56056642-56056664 GCCAGCAATGCTCTTCTTTCAGG + Intergenic
1097309378 12:58101959-58101981 GGCAGGCCTGCTTTCCTTTCTGG + Intergenic
1098857934 12:75674760-75674782 CACAGCCCTTCACTCCTTTATGG - Intergenic
1100122593 12:91386044-91386066 CCCAGCCCTGCCCTTCTGTCAGG + Intergenic
1102029525 12:109731874-109731896 CCCAGCCCAGCTCTCTGTTCAGG + Intronic
1102077686 12:110073162-110073184 CCCTGCCCTGCTCTCCCTGGCGG + Intronic
1103507739 12:121453081-121453103 CCCAGCCCTGCGCTCGATTCAGG - Intronic
1103557580 12:121775576-121775598 CCCAGCCTCGCCCTCCTCTCTGG + Intronic
1103788649 12:123453424-123453446 CCTAGGCATGCTCTACTTTCTGG + Intergenic
1104926286 12:132315714-132315736 CTCAGCCCTGGTGTCCTTGCGGG + Intronic
1105476156 13:20729816-20729838 CCCTGCCCTGCCCTCCTTGCAGG + Intronic
1108495300 13:51018916-51018938 CCCAACCCTGCTCTTCTTTCTGG + Intergenic
1112368323 13:98774054-98774076 ACCCGCCCTGCTGTCCTTCCGGG - Intergenic
1113527554 13:110992381-110992403 CCCATCCCTGCTCTGCTCTGAGG + Intergenic
1113796380 13:113061096-113061118 CCCAGCCCTTCTCTCATCCCTGG - Intronic
1114418078 14:22557317-22557339 CCAGGCCCTCCTCTCCTTTGGGG - Intronic
1114806003 14:25837839-25837861 CCCAGCCTCTCTCTCTTTTCTGG - Intergenic
1116168748 14:41370419-41370441 TTCAGGGCTGCTCTCCTTTCTGG - Intergenic
1117417980 14:55515576-55515598 TCCAACCCTGCTTGCCTTTCTGG - Intergenic
1118331392 14:64818491-64818513 CCACTCCCTGCTCTCCCTTCTGG + Intronic
1118751229 14:68808969-68808991 CCCAGCCCTGGTGTCCTTCTGGG - Intergenic
1118982891 14:70730526-70730548 TCCAGCCCTGCTCCCGTTCCAGG - Exonic
1119430256 14:74562952-74562974 CCCTGCCCTGGTCCCCTTTCTGG + Intronic
1119434774 14:74591174-74591196 CCCAGTCTTGTTCACCTTTCTGG - Intronic
1119970370 14:78963463-78963485 TCCAGCCCAGCTCCCCTTCCTGG + Intronic
1121017485 14:90557283-90557305 CCCAGCCCTGCTCTCCTGCAGGG - Intronic
1121388556 14:93554053-93554075 CCCAGCCATGCTGTCTTTACTGG - Intronic
1121438535 14:93934399-93934421 CCCAGACCTTCTCTACCTTCAGG - Exonic
1121447466 14:93988030-93988052 CCCACCCCTCTTCTCCTCTCTGG - Intergenic
1121452254 14:94016473-94016495 CCCAGCCCTGCTCTTGGCTCAGG + Intergenic
1121649189 14:95544721-95544743 TCGAGCCCTGGTCTACTTTCTGG + Intronic
1122111207 14:99504054-99504076 CCCAGCCCAGCTGCCCTTGCAGG + Exonic
1122809651 14:104281656-104281678 CCAAGCACTGCTGTCCCTTCAGG - Intergenic
1122886419 14:104712411-104712433 CCCGGCCCTCCTCACCTTTCAGG + Exonic
1122951672 14:105048333-105048355 CCTAGCCCTGCTGTCCCTACCGG + Intergenic
1122984192 14:105204797-105204819 CCCTGCCCTGCCCTCCCCTCTGG + Intergenic
1123536217 15:21187194-21187216 CCTAGCCCTGCTCTCTGTGCTGG - Intergenic
1124209984 15:27754629-27754651 CTCAGTCCTGCTCTCCCTGCAGG - Intergenic
1126110327 15:45171392-45171414 CACTGCCCTGCCCTCCTTCCAGG + Intronic
1127335301 15:57978711-57978733 CCCAGCCCTTCTCCCCTTCTGGG - Intronic
1127528431 15:59817269-59817291 CCCTGCAATGCTCTACTTTCTGG + Intergenic
1127529391 15:59828980-59829002 CTCAGCTCTGCTTTCCTTTTCGG + Intergenic
1127702988 15:61519248-61519270 CTCAGCCCTACCCTCCTCTCTGG + Intergenic
1127770763 15:62228708-62228730 CCCTGCCCTGGTCTCTCTTCTGG - Intergenic
1127776134 15:62265637-62265659 CCCAGCCCAGGTCTCTGTTCTGG - Intergenic
1127836956 15:62797740-62797762 CCCACACCAGCTCTCCCTTCAGG - Intronic
1128075133 15:64821131-64821153 CCTAGCTCTGCTCTCCTTGGGGG - Intronic
1128112786 15:65087099-65087121 CCCAGCCCTGCAGTCCTTCCAGG + Intergenic
1128155963 15:65392119-65392141 CCCAGCCCTCCTCACCTAGCTGG + Exonic
1128223010 15:65982085-65982107 CCCAGCCCTGGGCTCCTTGTGGG - Intronic
1128706054 15:69838068-69838090 CCCAGCCCTGTCCTACTGTCTGG - Intergenic
1129319948 15:74768946-74768968 CCCAGCCCTGTCCTCATGTCAGG + Intergenic
1129544860 15:76385172-76385194 CCCAGCTGTACTCTCCTTTAAGG - Intronic
1129685856 15:77685805-77685827 CACAACACTGCTCTCCATTCTGG + Intronic
1129905441 15:79183996-79184018 CCCAGCTCTGCCCTCCTGGCTGG + Intergenic
1130033905 15:80341012-80341034 CCCAGCCCTCCTCCCCATCCAGG + Intergenic
1130196711 15:81786173-81786195 GCTGGCCCTGCTCTCTTTTCTGG - Intergenic
1130302632 15:82691732-82691754 CACACCACTTCTCTCCTTTCAGG - Intronic
1131070782 15:89464417-89464439 GCCAGCCCTGCTATCCCTTAGGG + Intergenic
1132801629 16:1757578-1757600 CCCAGCCCTCCTCTGCTTTCTGG + Intronic
1132982568 16:2745986-2746008 CACAGCTCAGCTCTTCTTTCTGG - Intergenic
1133209960 16:4258025-4258047 CCCAGCCCTCCTCTCCCTTCTGG - Exonic
1133292903 16:4734496-4734518 CCCCGCCCAGCTCCTCTTTCGGG - Exonic
1133437583 16:5793215-5793237 CCCAGCCCTGCTGTGCTGACCGG + Intergenic
1133777411 16:8908088-8908110 CCCAGCCCTGCTCTCAGCTATGG - Intronic
1134456532 16:14399487-14399509 CGCAGCCCTGTACCCCTTTCTGG + Intergenic
1136333329 16:29595612-29595634 CCCAGCCCTCCGGTGCTTTCCGG - Intergenic
1136618704 16:31413755-31413777 ACCAGCTTTGCTCTCCCTTCTGG + Intronic
1136618980 16:31415479-31415501 GCCAGCCTCGCTCTCCCTTCTGG + Intronic
1137051995 16:35722342-35722364 CCCAGCCCTGGTCCCCATCCTGG - Intergenic
1138178005 16:54919822-54919844 CCTACCCCTGTTCTCCTTTAGGG - Intergenic
1138564779 16:57825091-57825113 CCCAGCCCAGCCCTCCTAGCAGG + Intronic
1138727986 16:59161799-59161821 CCCCTGCCAGCTCTCCTTTCTGG - Intergenic
1139503533 16:67387535-67387557 CCCAGACCTGTCCTGCTTTCTGG - Intergenic
1139659498 16:68411209-68411231 CCCAGGCCTGTTCTCCTGCCAGG + Intronic
1139852564 16:69959872-69959894 CCCAGCCCTGCTCTCGTGGCAGG + Intronic
1139881535 16:70182780-70182802 CCCAGCCCTGCTCTCGTGGCAGG + Intronic
1139924382 16:70478183-70478205 CCCGGCCCTGCACCCCTTGCTGG - Intronic
1140068072 16:71626689-71626711 CCCGGCCCCTCTCACCTTTCGGG - Exonic
1140370974 16:74412725-74412747 CCCAGCCCTGCTCTCGTGGCAGG - Intronic
1141275961 16:82588442-82588464 CCCAGTCCTGCTCTCTTCTAGGG + Intergenic
1141296362 16:82773390-82773412 CCCTGCCCTGCTCCCACTTCTGG + Intronic
1141367337 16:83455961-83455983 CTCAGCCCTGCTGTCTTTACAGG - Intronic
1141919456 16:87126257-87126279 CCCAGCCCTGCTCCCGACTCTGG + Intronic
1142245009 16:88966366-88966388 CCCCGCTCTGCTCTCCTCTGTGG - Intronic
1142400941 16:89858527-89858549 CCCATTCCTGGTCTCTTTTCAGG - Intronic
1143028214 17:3953283-3953305 CCCAGCCTGGCTCTCCCTCCAGG + Intronic
1143437431 17:6939729-6939751 TCCAGCCCTGCTACCCCTTCAGG - Intronic
1143449759 17:7028992-7029014 CCCATCCCTGCATTCCTGTCTGG + Exonic
1143500320 17:7335084-7335106 CCCAGCCCTCCAATTCTTTCAGG + Intergenic
1143500684 17:7336857-7336879 CCCAGGCCAGGTCTCCTTCCAGG + Intronic
1143615618 17:8047542-8047564 CCCAGCCCAGCTCTCCTTGCAGG + Exonic
1143618142 17:8065545-8065567 CCCAGCCATTCTCACCTATCAGG + Intergenic
1143998744 17:11032759-11032781 CCCAGCTCTCCACTCCTTCCTGG - Intergenic
1144094950 17:11891926-11891948 CCTTGCCCAGCTCACCTTTCAGG + Exonic
1144676301 17:17164369-17164391 CCCGGCCCTGCTCCCGCTTCAGG - Intronic
1145784423 17:27584847-27584869 CCCTGCCTGACTCTCCTTTCAGG + Intronic
1145976778 17:28988477-28988499 CCCACTCCTGCTCACCTTGCTGG - Intronic
1147139374 17:38452784-38452806 CCCTGCCCTGCTCGCCTTCCTGG - Intronic
1147161392 17:38571432-38571454 CCCAGCACTGCTCAGCCTTCTGG + Intronic
1147210522 17:38870312-38870334 CCCGGCCCTTCTCTCCTCCCTGG - Intronic
1147672500 17:42184624-42184646 TCCAAGCCTGCACTCCTTTCTGG + Intronic
1148101330 17:45093663-45093685 CACAGCTGTGCTCTTCTTTCAGG + Exonic
1148731365 17:49838774-49838796 CCTAACCCCTCTCTCCTTTCTGG + Intronic
1148969452 17:51466847-51466869 CCCAGTCCTTCTCTCCCTACAGG + Intergenic
1152334954 17:79695490-79695512 CCCAGCCCTGCTCCCCTGGGGGG + Intergenic
1152422917 17:80203763-80203785 CCCTGCCCTGCTCACCTGGCAGG + Intronic
1152544288 17:80992811-80992833 GCTAGCCCTGCTTTCATTTCGGG - Intronic
1152723183 17:81932792-81932814 CCCCTCCCTGCCCTCCATTCAGG - Intronic
1152745374 17:82036369-82036391 CCCAGCCCTGCTCACCTTGTGGG + Exonic
1152993030 18:379816-379838 CCCAGCCATGCTCACATGTCGGG - Intronic
1154005261 18:10521954-10521976 CCCATACCTGCTCTCCCTTCAGG - Intergenic
1155300084 18:24421022-24421044 CCCACCACTGCACTCCTGTCTGG - Intergenic
1155621427 18:27784837-27784859 CCTAGCCCTGCTATGCTTTTAGG - Intergenic
1156057916 18:33033078-33033100 CCCATCACTGCTCTCATTTATGG + Intronic
1156299359 18:35822426-35822448 CACAGCCATGCATTCCTTTCTGG + Intergenic
1157166158 18:45360008-45360030 CCAGGCCCTGCACTCCTGTCAGG + Intronic
1157335514 18:46734404-46734426 CCCACCCCTGCTCTCCACCCTGG + Intronic
1157784324 18:50468583-50468605 CTCAGCACAGCTCTCCTTTGGGG - Intergenic
1158721189 18:59926235-59926257 CGCACCCCTGCTCTCCAGTCTGG - Intergenic
1159423402 18:68252281-68252303 CCCACCACTGCCCTCCTGTCTGG - Intergenic
1159868629 18:73735520-73735542 CCCAGGCATGCTCTTTTTTCAGG - Intergenic
1160223266 18:76992547-76992569 CCCTGCCCTGCCCACCCTTCAGG + Intronic
1161013851 19:1973503-1973525 CCCAGCCTTGCTCTCATTCCTGG + Intronic
1161241285 19:3225151-3225173 CCCACCCCTCCTCCCCTCTCTGG + Intronic
1161513102 19:4682661-4682683 CCCTGCCCTGCGCTCCTCCCCGG - Intronic
1161523323 19:4738208-4738230 CCCAGCTCTCCTCTCCTCTGGGG - Intergenic
1161958166 19:7507718-7507740 CCCAGCCCTGGAGTCCTTCCAGG + Intronic
1162078657 19:8205856-8205878 GCCAGCCCTGCTGTCCTCCCAGG + Intronic
1162367324 19:10257390-10257412 GCCAGCTCTCCTCACCTTTCAGG + Intronic
1163183765 19:15622192-15622214 CCCAGCCCTGCTCCCTTCTCTGG + Intronic
1164627377 19:29738422-29738444 CCCACCCCTGCCCTCCCTACAGG + Intergenic
1164982365 19:32623869-32623891 CTCACCCCTGCTCTCCTCTCTGG + Intronic
1165046410 19:33108328-33108350 CCCGCCCCTGCCCGCCTTTCAGG + Intronic
1165162086 19:33822552-33822574 AACAGAGCTGCTCTCCTTTCTGG + Intergenic
1165793876 19:38507430-38507452 CTCAGCCCTTCTCTCCTCTTTGG - Intronic
1165898370 19:39156539-39156561 CCCAGCCCTGCCCTCTGTCCAGG + Intronic
1166106018 19:40598375-40598397 CCCCCCACTGCTCTCCTCTCGGG + Intronic
1166800503 19:45454088-45454110 CCCAGCCGTGGTCTGGTTTCAGG + Intronic
1166950942 19:46427817-46427839 TCCAGCCTTGCTCTCCTTCTCGG + Intergenic
1167159331 19:47756877-47756899 CCCAACCCCGCTCTGGTTTCAGG - Intronic
1167311662 19:48740669-48740691 CCCAGGCCTGGTCTCCTCACAGG - Exonic
1167578978 19:50331055-50331077 CCCACCCCCGCTCCCGTTTCTGG + Intronic
1167853439 19:52219551-52219573 CCAAGCCCAGCTCCCCGTTCTGG - Intronic
1168231146 19:55032396-55032418 CCCAGCCCTGCTCCTCTTCCAGG - Exonic
925743002 2:7021478-7021500 CACACCCCTGGTCTCCTTCCGGG + Intronic
926169058 2:10539571-10539593 TCCAGCCCCTCTCTCCTTCCTGG - Intergenic
926678979 2:15649734-15649756 CCTGGCCCTGGTCTCCTCTCAGG - Intergenic
926696446 2:15772549-15772571 CCCAGCCCTGCCCTCTTTGCAGG - Intergenic
927315463 2:21676119-21676141 TCCAGCCCCTCTCTCCTTCCTGG - Intergenic
927462434 2:23310635-23310657 CCCACCCCTGGTTTTCTTTCTGG - Intergenic
927471845 2:23383568-23383590 CCCACTCCTGCTCCCCTTTTCGG + Intergenic
927652944 2:24923191-24923213 CCCATCCCTGCTCCGCGTTCAGG + Intergenic
928136178 2:28689286-28689308 CCCACCCCTCCCCTACTTTCAGG + Intergenic
928200356 2:29244058-29244080 ACCAGCTGTGCTCTCATTTCAGG - Intronic
929581922 2:43086835-43086857 CCCCTCCCTGCTCTCCTTCCAGG + Intergenic
932408313 2:71528906-71528928 CCCAGCCCTTCTCTCCACACAGG + Intronic
932714240 2:74090040-74090062 CCCAGCTCTGCTCACCTCTTTGG - Exonic
932850839 2:75183684-75183706 CCCAGCCGTGTACTCCTTCCTGG - Intronic
933509264 2:83218946-83218968 CCCAGACCTGGTCACCTGTCTGG - Intergenic
933629117 2:84636226-84636248 CCCAGCCTAGCTATGCTTTCTGG + Intronic
934564419 2:95330422-95330444 CCCAGCCCTGCTCTCAGGGCAGG + Intronic
935019819 2:99219174-99219196 CGCATCCCTGCACTCCTTTCTGG + Intronic
935097977 2:99965424-99965446 TCCAGTCCTGCTCTCTTTCCTGG + Intronic
935112494 2:100105402-100105424 CCCGGACCTGCTCTCCGTTGCGG + Intronic
935593522 2:104862540-104862562 CCCAGCCCTGCCCTCCCTCCCGG - Intergenic
936063512 2:109313476-109313498 CCAGGCCCTGCCCTCCTTGCTGG + Intronic
936085702 2:109467484-109467506 CCCAGTCCTGCTGTCCTTCCAGG - Intronic
936461189 2:112714708-112714730 CCCAGCACTGGGCTCCTTGCTGG + Intergenic
937247730 2:120504287-120504309 CCCAGCCGTGGGTTCCTTTCAGG - Intergenic
939497446 2:142941077-142941099 CCCAGCCCTCCTCTCCCTCTGGG + Intronic
940377115 2:152969287-152969309 TCCAGCCCTGCTACCCTTTAAGG - Intergenic
941856434 2:170235678-170235700 CCCAACCCTGCTATTCTTTAAGG - Intronic
941874054 2:170415726-170415748 ACCATCCCTGCTCTTCTTACAGG + Intronic
943904517 2:193480721-193480743 CACACCCCTGCTCTCCCTTGAGG - Intergenic
944168173 2:196745236-196745258 CTCTGTCCAGCTCTCCTTTCTGG - Intronic
944652244 2:201842802-201842824 CCCAGCACATCTCTCCCTTCTGG + Intronic
944665275 2:201954239-201954261 CCCAGCCCAGCTTTCCTTCAGGG - Intergenic
945047233 2:205792666-205792688 CCCAGACCTGCTGTGGTTTCTGG + Intronic
946171307 2:217897604-217897626 TCCAGCCCAGCTCTCCTCTAAGG - Intronic
947871715 2:233442261-233442283 CCCAGCCCTGCTCCCCATGTGGG - Intronic
948556389 2:238814208-238814230 CCCAGCCCTGCTTTCCTTCCTGG + Intergenic
948590868 2:239049256-239049278 CCCCGCCCTCCTCTCCTTCAAGG + Exonic
948861521 2:240754963-240754985 CCCAGCCCTGCTCCCCTCCCAGG + Intronic
948884772 2:240877156-240877178 CCCAGGCCCCCTCTCCTCTCAGG - Intronic
1170521292 20:17188265-17188287 CCCAGACCTGGTCACCTGTCTGG + Intergenic
1170554495 20:17504597-17504619 CTCATTCCTTCTCTCCTTTCTGG - Intronic
1170792135 20:19517105-19517127 CCCAGCCCTCCCTGCCTTTCAGG + Intronic
1171292286 20:23989269-23989291 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1171328640 20:24318198-24318220 CTCAGCCCTGCTCCCCATCCCGG + Intergenic
1171395515 20:24830347-24830369 CCCACCTCTTCTCCCCTTTCTGG - Intergenic
1171464625 20:25318991-25319013 CCCAGCACAGCTCTCCTTGCTGG + Intronic
1172030651 20:31979910-31979932 GCCAGCTCTCCTCTCCTCTCTGG - Intronic
1172332404 20:34084413-34084435 CCAAGCCTTGCTCTCCTTTTGGG - Intronic
1172602531 20:36194007-36194029 CCCAGCCCAGGACTCCTTCCTGG - Intronic
1172684641 20:36744907-36744929 CCCAGTCCTGCTCTCTTGGCAGG + Intronic
1173013836 20:39207444-39207466 CCCAGGCTTTCTCTTCTTTCTGG + Intergenic
1173673747 20:44815945-44815967 CCCAGCCATGGCCTCCTATCCGG - Intergenic
1173817273 20:45997829-45997851 CCCAGCCCTGCTCCTCCCTCTGG - Intergenic
1173929510 20:46807022-46807044 CCTAGGCCTGCTCTCCTTAATGG - Intergenic
1174046351 20:47736688-47736710 CCCGTCCCTGCTCACCTGTCCGG + Exonic
1174357841 20:50010153-50010175 CCCAGCCCGGCTCACGTTTCCGG - Intergenic
1174462002 20:50689823-50689845 TCCAGGCCTCCTTTCCTTTCAGG - Intronic
1175014675 20:55776777-55776799 CCCAGCCCTACTCCCCTGACAGG + Intergenic
1175201824 20:57283343-57283365 AACAGCCCAGCTCTCCTTTGCGG - Intergenic
1175472045 20:59237279-59237301 CACAGCCCTGCTATCCTCTTAGG - Intronic
1175544348 20:59768687-59768709 CCCAGCCCTTGGCTCTTTTCTGG + Intronic
1175795225 20:61766688-61766710 CCCCACCCTGCTTTCCTTCCAGG + Intronic
1175805930 20:61829539-61829561 AGCAGCTCTGCTCGCCTTTCTGG + Intronic
1176133363 20:63506946-63506968 CCCAGCCACACTCTGCTTTCTGG - Intergenic
1176246935 20:64101990-64102012 CCCAGCCCACCTCTGCTGTCGGG + Intergenic
1177755663 21:25344170-25344192 AACAGCCCTTCTCTTCTTTCTGG - Intergenic
1178249719 21:30990777-30990799 CCCAGCCCCGCTCCCCCTGCTGG - Intergenic
1178699361 21:34820157-34820179 CCCAGCCCTGCTCCCTGTTGGGG - Intronic
1179015828 21:37593917-37593939 GCCAGCGCTGCCTTCCTTTCAGG + Intergenic
1179175082 21:39002328-39002350 GGCGGCGCTGCTCTCCTTTCTGG - Intergenic
1180013670 21:45069023-45069045 TCCAGCACGGCTCTCCTCTCCGG + Intergenic
1180823353 22:18847032-18847054 CCCTGCCCCGCTCTCCTTGAGGG - Exonic
1180848448 22:18997476-18997498 CCCTGCCCTGCTGTCCTTCAGGG + Intergenic
1181123728 22:20689909-20689931 GCAAGCCCTGCCTTCCTTTCTGG + Intergenic
1181123777 22:20690131-20690153 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181189390 22:21127514-21127536 CCCTGCCCCGCTCTCCTTGAGGG + Exonic
1181209809 22:21282981-21283003 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181256366 22:21565414-21565436 CCCTTTCCTTCTCTCCTTTCAGG + Intronic
1181399707 22:22643963-22643985 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1181517959 22:23426832-23426854 CCCAGCCCTGCTTTCAGTTAAGG + Intergenic
1181584528 22:23845805-23845827 CCCAGCCCTGCAGGCCTCTCTGG - Intergenic
1181649708 22:24252105-24252127 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1181707664 22:24658641-24658663 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1181749792 22:24981307-24981329 CCCAGGCCAGCTCTCCTTGGGGG - Intronic
1181934880 22:26430913-26430935 CCCAGCCCTGTACTCTTCTCAGG - Intronic
1182112234 22:27732043-27732065 CCCTGGCTTGCTCACCTTTCTGG + Intergenic
1182714748 22:32348466-32348488 CCCAGCTCTCCCCTCCTTCCTGG - Intergenic
1183420437 22:37708829-37708851 CCCAGCTCTGATTTCCTGTCTGG - Intronic
1183932922 22:41246357-41246379 CCCAGCCCTGCTCTGTTGTGGGG - Exonic
1184235388 22:43180431-43180453 CCCACCCCTGCTGGCCTCTCCGG - Intronic
1184240858 22:43210624-43210646 CCAGGCCCTGCTCTAGTTTCTGG - Intronic
1184367678 22:44062918-44062940 TCCAGCCCCTCTCCCCTTTCTGG + Intronic
1184413410 22:44338526-44338548 CCCAGCCCTGGCCTCCTCTGAGG + Intergenic
1184520463 22:44991028-44991050 CCCCGCCCTGCCCACCTTCCAGG + Intronic
1184610868 22:45602285-45602307 CCCAGCCCTGCTTCCCTGCCAGG - Intergenic
1184865191 22:47198257-47198279 CCCAGCCCTGGCCTCCTCGCTGG - Intergenic
1184927336 22:47652480-47652502 CCCTGCCCTGCCGTCCTTCCAGG - Intergenic
1185066954 22:48637147-48637169 CCCAGCCCTGCCCACCATACAGG - Intronic
1185098255 22:48823194-48823216 CCCATCCCTGCTGTCCTCCCTGG + Intronic
1185224160 22:49643620-49643642 CCCAGGCCATCTCTCCTTCCGGG + Intronic
1185229367 22:49671227-49671249 CTCAGCCCCGCCCTCCTTTTGGG - Intergenic
1185289825 22:50017674-50017696 CCCAGCCCTGGCCTCCATACAGG - Intronic
1203217136 22_KI270731v1_random:12452-12474 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
1203273493 22_KI270734v1_random:72938-72960 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
949350338 3:3119237-3119259 CCCAGCCCCACCCACCTTTCTGG - Intronic
950040929 3:9918513-9918535 CCAAGTCGTGCTCTCCTTCCAGG + Exonic
950078578 3:10205289-10205311 CCCAGCCCTCCCCTCCTCTGGGG - Intronic
950181685 3:10917980-10918002 CCCAGCCTTTCTCTCCTACCAGG + Intronic
951190530 3:19764547-19764569 CCCAACCCTGCACACCTTTGGGG + Intergenic
951390291 3:22094656-22094678 CCCAGCCCAGGGCTCCTCTCTGG - Intronic
951528619 3:23678258-23678280 CCCAGCCCTGCTCACCTTCCTGG + Intergenic
951593904 3:24296655-24296677 GCAAGCCCTGTCCTCCTTTCTGG + Intronic
952186114 3:30970764-30970786 CCCAACATTGCTCTTCTTTCTGG + Intergenic
953564211 3:44017100-44017122 CCCAACCCTGCTGTCATCTCTGG + Intergenic
953596315 3:44318127-44318149 CCCAGCCCTTCTCCCCTTCCTGG - Intronic
953715014 3:45310032-45310054 GCCAGCCCTACTCTCCTCCCTGG + Intergenic
954944093 3:54402462-54402484 GCCAGCCCTGCTCTTTTTTTTGG - Intronic
955060735 3:55489543-55489565 CCCAGCCCTGGCCTCCTTCCTGG + Intronic
955348445 3:58177805-58177827 CCCAGCTCCGCTCCCCTCTCGGG + Intergenic
955952977 3:64260771-64260793 CCCAGACTTGCTCTTCTCTCTGG - Intronic
956588615 3:70889560-70889582 CCCACTCCTGCTCTCCTGCCAGG - Intergenic
956679395 3:71764343-71764365 CTCAGCCCAGCTCTGCTTCCTGG + Intergenic
956727601 3:72169262-72169284 CCCATCCCTCCTCTACCTTCAGG + Intergenic
959966614 3:112362915-112362937 CCCAGCCCAGCTCATCTTTTAGG - Intergenic
960604048 3:119486750-119486772 CCTAGTCCTGCTCACCTTTCAGG + Intronic
961091390 3:124115574-124115596 CCGAGCCCTGCTGCCCTTCCTGG + Intronic
961606574 3:128099884-128099906 CCCAGCCCAGCACTCTTCTCAGG + Intronic
964651158 3:159013143-159013165 CCCTCCCCTGATCTCCTTACTGG - Intronic
965516118 3:169622916-169622938 CCCAACTCAGCTCTGCTTTCAGG + Intronic
967085404 3:186090790-186090812 CCCAGCCCTGCTCAGCATTTAGG - Intronic
967473668 3:189891235-189891257 CGGTGCCCTGCTATCCTTTCTGG - Intronic
967884171 3:194322073-194322095 CCCACCCCACCTCTCCTCTCTGG - Intergenic
968377960 4:60074-60096 CCCAGACCTGGTCACCTGTCTGG + Exonic
968406504 4:344351-344373 CCCAGACCTGGTCACCTGTCTGG + Exonic
968621557 4:1605582-1605604 CCCATCCCTCCTCTCCCTGCGGG + Intergenic
968624021 4:1618478-1618500 CCCATCCCTGCTCACCTGTCTGG - Intronic
968921149 4:3522803-3522825 CCCTGCCCTGCTCTGCTCTGGGG - Intronic
969681990 4:8648337-8648359 CCCACCCCTCCCCTCCTTTTTGG + Intergenic
971053335 4:22885735-22885757 CACAGCCATGCTCATCTTTCTGG + Intergenic
971195583 4:24470231-24470253 CCAAGCCCTGCTCGTCTTTGAGG - Intergenic
971265540 4:25093548-25093570 CCCTTCCCTGCTCTCCATTGAGG - Intergenic
971484085 4:27141681-27141703 CCCACCCCCACCCTCCTTTCAGG - Intergenic
973560445 4:52130111-52130133 CCCACCCCTGCCCTCCTGGCAGG + Intergenic
976354221 4:84097203-84097225 GCCAGCTCAGCTCTCCCTTCAGG + Intergenic
978406044 4:108379873-108379895 CCCAGACTTGCTCTCCTTTGTGG + Intergenic
980950841 4:139374810-139374832 CCCAACCCAGATCTCCTTTGGGG + Intronic
981567196 4:146113934-146113956 CGCAGCCCTGGTCTGCTCTCGGG - Intergenic
981643575 4:146973053-146973075 TCCAGCCCTTCTCCCCTTCCTGG + Intergenic
981777838 4:148390509-148390531 CCCTACCTTGCCCTCCTTTCAGG - Intronic
982094774 4:151911918-151911940 CTGAGCACTGCTCTCCTTTGGGG - Intergenic
985480692 5:108437-108459 ACCAGCCCTGCTTTCCACTCAGG - Intergenic
985680783 5:1254538-1254560 CCCAGCCCAGCTCCCCTCCCAGG + Intronic
985773234 5:1825814-1825836 CTCTGCCCGGCTCTCCTTGCGGG + Intergenic
985933760 5:3079303-3079325 CCCATCCCTCCTATCCTTGCTGG - Intergenic
986213916 5:5699962-5699984 TCAAACCCTGCTCTCCCTTCTGG - Intergenic
986816324 5:11415734-11415756 TCCAGCACTCCTCTCCTTGCAGG + Intronic
987708690 5:21484012-21484034 CCCTGCCCTGCTCTCCTTGAGGG + Intergenic
988750919 5:34190133-34190155 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
989565075 5:42893994-42894016 CCCAGGCTTGCTCTCGATTCAGG - Intergenic
989565783 5:42899429-42899451 CCCAGACTTGCTCTCGGTTCAGG + Intergenic
989573818 5:42971015-42971037 CCCAGGCTTGCTCTCGGTTCAGG - Intergenic
989796594 5:45482153-45482175 CCCAGCCTTTGTCTTCTTTCTGG - Intronic
990205707 5:53426673-53426695 CCCACCCCGTATCTCCTTTCTGG + Intergenic
991736059 5:69632057-69632079 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991739188 5:69653345-69653367 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991759010 5:69903086-69903108 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
991788326 5:70215036-70215058 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991790763 5:70233086-70233108 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991812558 5:70487696-70487718 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991815515 5:70508173-70508195 CCCTGCCCTGCTCTCCTTGAGGG - Intergenic
991818649 5:70529462-70529484 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991838239 5:70778152-70778174 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
991880773 5:71215400-71215422 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991883210 5:71233421-71233443 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
991944850 5:71890115-71890137 CCTACCCCTGCCCACCTTTCTGG - Intergenic
992378223 5:76210672-76210694 CCCAGCCCCTCTCCCCTTCCTGG + Intronic
993166057 5:84356386-84356408 TCCAGAACTGCACTCCTTTCTGG + Intronic
993176489 5:84492885-84492907 CCCAGTCCTGCCCTTCTTTTGGG - Intergenic
994420822 5:99525362-99525384 CCCTGCCCCGCTCTCCTTGAGGG + Intergenic
994486221 5:100388952-100388974 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
996095017 5:119389322-119389344 CTCAGCCCTGACCTCTTTTCTGG - Intronic
997202324 5:132018436-132018458 CCCCGCCCTGCTGGCCTTTCTGG - Intergenic
999654227 5:153796938-153796960 CCCATCCCTGCCCTCCTCACAGG + Intronic
999977855 5:156929656-156929678 CACAGCCATGCTCTCCTTGGAGG - Intronic
1000345543 5:160311139-160311161 CTCAGCCCTTCTCTCCTTGAGGG + Intronic
1000359547 5:160434319-160434341 CCCTACACTGCTGTCCTTTCTGG - Intergenic
1001124955 5:169011033-169011055 CTGAGCCCTGCTCTTCTTTCTGG - Intronic
1001400507 5:171443761-171443783 CCCTTTGCTGCTCTCCTTTCTGG + Intronic
1001816408 5:174672958-174672980 CCCAGCCTTGTTCTCCCTACTGG + Intergenic
1001936758 5:175710937-175710959 GCCAGCCCTTCCCTCATTTCTGG - Intergenic
1002122809 5:177018657-177018679 CCCAGGCCTGGACTCCTTGCTGG - Intronic
1002601460 5:180356256-180356278 TCCAGACCAGGTCTCCTTTCTGG - Intergenic
1002614098 5:180439611-180439633 CCCAGCCTTGCTTTCCTCACTGG + Intergenic
1003062485 6:2874561-2874583 CCCAGCCCTGGCCTCCATCCTGG + Intergenic
1004584666 6:16987964-16987986 CCAAGCCCTACTCTGTTTTCTGG - Intergenic
1005295913 6:24427287-24427309 CCAAGGCCTGCTTTCCTCTCCGG + Intronic
1005548996 6:26896438-26896460 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1006153523 6:32001873-32001895 CCCAGCCCTGCCCGCCTCTCCGG - Intronic
1006159831 6:32034610-32034632 CCCAGCCCTGCCCGCCTCTCCGG - Intronic
1006191145 6:32210311-32210333 CCCAGCCCTGCCTGCCTCTCAGG - Intronic
1006408663 6:33859529-33859551 CCCAGCCCTCCTCTGCTCCCTGG - Intergenic
1006437079 6:34031256-34031278 ACCATCCCTGCTCTCCTGTGTGG + Intronic
1006572955 6:35020583-35020605 CCCAGCACTGCTGACCTCTCTGG - Intronic
1007458239 6:41997477-41997499 CCCAGCCCTTGTCCCCTTGCCGG - Intronic
1007583187 6:42971696-42971718 TCCAACCCTGCTTTCCTTGCGGG + Intronic
1008331812 6:50254587-50254609 CACTGCCATGCTCTCCCTTCAGG - Intergenic
1009019746 6:57937548-57937570 CCCTGCCCCGCTCTCCTTGAGGG - Intergenic
1012724889 6:102798698-102798720 CCCAGCCCTTCTCTTCTCTACGG - Intergenic
1013574203 6:111464704-111464726 CCCGGCCCTGTTTTCCTTTTTGG - Intronic
1015100753 6:129476873-129476895 TCCACCCCCGCACTCCTTTCTGG - Intronic
1015842735 6:137491179-137491201 CCTAGACGTGCTCTCCTTGCTGG + Intergenic
1016489435 6:144580910-144580932 CCCTGCCATTGTCTCCTTTCTGG - Intronic
1016892123 6:149016964-149016986 CCCTGCCCTGCTCACATTTGAGG - Intronic
1017764771 6:157597654-157597676 CCCAGCCCTGCTGTCCTGTGTGG + Intronic
1018215668 6:161524890-161524912 GCCAGCCCTGCTCTTCTGACAGG - Intronic
1018381782 6:163264566-163264588 CCCAGCCCAGATCTTGTTTCTGG - Intronic
1018786438 6:167111837-167111859 CCCAGCCCAGCTCTCCTCTCCGG - Intergenic
1018826416 6:167410651-167410673 GCCAGCCCTGCCTTGCTTTCTGG - Intergenic
1018940786 6:168307974-168307996 CCAAGCCCTGTTCCCCTTTGAGG - Exonic
1019328959 7:453299-453321 ACCAGCCATGCTCTCCTGGCAGG + Intergenic
1020139406 7:5604334-5604356 CCCTGCTCTCCTCTCCTTCCCGG - Intronic
1021131362 7:16916439-16916461 CCCAGCCCTTCACTCCATTCAGG + Intergenic
1021828136 7:24574029-24574051 CCCAGGCCGGCTCTCCATTCAGG - Intronic
1023931757 7:44710408-44710430 CAAAGCCCTGTTCTCCTTGCAGG - Intergenic
1024255220 7:47535882-47535904 CCCAGCTATGTTTTCCTTTCAGG + Intronic
1024731784 7:52261278-52261300 GCCAGCCCTCCTCTTCTTTCTGG + Intergenic
1025790176 7:64681263-64681285 CTCCACCCTGCCCTCCTTTCAGG + Intronic
1026355174 7:69551164-69551186 GCCTGCCCTGCTCTGCTTCCAGG - Intergenic
1027202244 7:76071638-76071660 CCAGGCCCAGCTCTCCTTGCCGG - Intergenic
1028235852 7:88360939-88360961 TCCAGCCCCCATCTCCTTTCTGG - Intergenic
1028402765 7:90442293-90442315 CCCAGCTCTGGTCTCTTTTTGGG - Intronic
1028923109 7:96328348-96328370 CACAGCCCTGCTCTGCTCTCAGG - Intergenic
1029439986 7:100582214-100582236 CCCAGCACTGCCATCCTCTCGGG + Intronic
1030047804 7:105513025-105513047 CCAACACCTGCTCTTCTTTCTGG - Intronic
1031562380 7:123254261-123254283 CCCAGCCGTCCCCTCCTTTTAGG - Intergenic
1032592440 7:133204648-133204670 CCCAGCCAGGCTTTCCTTTTTGG - Intergenic
1033330746 7:140414983-140415005 CCCAGCCCTGCTTTCTTCTGGGG + Intronic
1033600197 7:142883828-142883850 CCCTGCCCTGATCTCCTTACTGG - Intronic
1034413971 7:150955468-150955490 CCCTGTCCTGCTCGCCTTCCCGG + Intronic
1034509177 7:151520173-151520195 CCCCGCCCTGCGCTCCGTTCTGG - Intergenic
1034677628 7:152903033-152903055 CCCAGCCCTCCACTCCCTACAGG - Intergenic
1034964765 7:155384209-155384231 CCCAGTCCTGCTCACCTGTTGGG + Intronic
1036597395 8:10226279-10226301 CCCAGCTCTGCTGTTCCTTCTGG + Intronic
1036979690 8:13456501-13456523 TCCAGCCCTGCGCTCCACTCTGG - Intronic
1037935868 8:22914698-22914720 CCCAGCCCTGCCTTCTCTTCTGG + Intronic
1037985463 8:23288254-23288276 CCCTGCGCTGCGCTCCTTCCCGG - Intronic
1038321600 8:26532077-26532099 ATCAGTCCTGCTCTCCCTTCTGG - Intronic
1039586289 8:38709998-38710020 CTCAGCCCTGCTCATCCTTCAGG + Intergenic
1039715839 8:40107861-40107883 CCCTGTCCATCTCTCCTTTCAGG + Intergenic
1040606282 8:48935145-48935167 CCCAGCCCTTTCCTCCTTTCAGG - Intergenic
1040835354 8:51724873-51724895 CCCAGCCCAGCTCTTCCTCCAGG + Intronic
1041063784 8:54061563-54061585 CCCAGGCTTGTTTTCCTTTCTGG - Intronic
1041800389 8:61791646-61791668 CACAATCCTGCTCTCCTCTCAGG - Intergenic
1042152178 8:65799709-65799731 TCCAGCCCAGCTCTCTTTCCAGG - Intronic
1043834494 8:85031623-85031645 CCCAGTCCTGCTTTCCTTTATGG - Intergenic
1044702635 8:94978196-94978218 TCCAGCTCTGCTCCCCTTCCTGG - Intronic
1044835263 8:96289248-96289270 TCCAGTCTTGCTCTCCTTTCCGG + Intronic
1045017304 8:98010658-98010680 GCCAGGCCTGCTCTCCTTGGAGG + Intronic
1045358958 8:101414370-101414392 CCCTGCCCTGCCCTCCTGACCGG + Intergenic
1046936188 8:119887498-119887520 CCCTTCCCTTCTCTTCTTTCTGG + Intronic
1047204921 8:122795367-122795389 CCTAGCCCTGCTCCCTTGTCTGG + Intronic
1047727349 8:127695381-127695403 CCAAGCCCTGTGCTCCTTACTGG - Intergenic
1048174056 8:132135500-132135522 CCCAGCCATGCTGACCTTGCGGG - Intronic
1048883814 8:138892545-138892567 CCCAGCCCTGAGCTGTTTTCAGG + Intronic
1049537403 8:143188763-143188785 GCCGGCCCTGCCCTCCTTGCAGG - Intergenic
1049838136 8:144753668-144753690 CCCATCCATTCTCACCTTTCTGG + Exonic
1051440661 9:17079288-17079310 CACAGCCCTGATCTATTTTCAGG - Intergenic
1051567068 9:18512247-18512269 CCAAGATCTGATCTCCTTTCCGG + Intronic
1052835585 9:33247671-33247693 TCTAGCCCTGCTCATCTTTCTGG - Intronic
1055404500 9:75960415-75960437 CCCAGCCCCTATTTCCTTTCAGG - Intronic
1056121618 9:83493882-83493904 CACAGTCATGCTCTCCTTTGTGG + Intronic
1056936720 9:90920141-90920163 CCCAGCCAGCCTCTCCTTGCTGG + Intergenic
1057005129 9:91550546-91550568 CCCAGCACTGCTCTGCTTCTAGG - Intergenic
1057075137 9:92134639-92134661 CCCCTCCCTGCCCACCTTTCTGG - Intergenic
1057077766 9:92147845-92147867 CCCAGCCCTGCCCGCCTCTCGGG - Intergenic
1060749611 9:126160396-126160418 CACAGCTCTGCTCTCCTGACTGG - Intergenic
1060854314 9:126902783-126902805 TCCAGCCCTTCTCTCCTGTCTGG + Intergenic
1061894983 9:133642495-133642517 CCCAGCCCTGCCTTCCTCCCGGG + Intronic
1062082063 9:134629490-134629512 CCCTGCCCAGCTCGCATTTCTGG + Intergenic
1062282557 9:135758554-135758576 CCCGGCCCTGCTTGCCTCTCGGG - Intronic
1062333813 9:136056229-136056251 GGCAGCCCAGCTCTGCTTTCTGG - Intronic
1062418017 9:136463242-136463264 CCCAGCCTTGCCAGCCTTTCGGG - Intronic
1062421374 9:136484136-136484158 CCCAGCCCTGCTGTCCTCCCGGG + Exonic
1062435511 9:136545158-136545180 CCCAGCCCGGCTCTCAGTTTGGG - Intronic
1062475047 9:136722577-136722599 ACAAGCCCTGGTCTCCATTCGGG - Intronic
1203571278 Un_KI270744v1:134173-134195 CCCAGACCTGGTCACCTGTCTGG - Intergenic
1186643748 X:11484265-11484287 CCCTGCCCTCCTCTCTTTTTTGG - Intronic
1188247471 X:27853530-27853552 CCCAGCCCTGCTTTCACTCCTGG + Intergenic
1189019061 X:37315901-37315923 CCTAGCCCCTCTCTCCTTCCTGG + Intergenic
1189928829 X:45986137-45986159 CCCTCCCCACCTCTCCTTTCTGG + Intergenic
1190056075 X:47181714-47181736 CTGAGCCCTGTTCTCCTGTCTGG + Intronic
1190117703 X:47637012-47637034 CCCGGCCAAGCTCTCCTTCCAGG - Exonic
1190456809 X:50635181-50635203 CCCTGCGCTGCTCTCCATTGAGG + Exonic
1190652852 X:52583406-52583428 CCCAGCCCTGATCCCCCTTGAGG - Intergenic
1191741013 X:64434968-64434990 CTCTGCCCTGCTTCCCTTTCTGG + Intergenic
1191951670 X:66599775-66599797 CTCAGCACTGGTCTCCTTGCTGG + Exonic
1192234991 X:69289949-69289971 TCCATCCCTGCTCTCCTGGCAGG + Intergenic
1195427988 X:104756876-104756898 CCCAGGCATGCTCTCGTCTCAGG - Intronic
1195614254 X:106900375-106900397 CCCTGCCCTGCTCTGCTTCCTGG + Exonic
1196741831 X:119032006-119032028 CCAGGCCCTGCTCCCCTGTCAGG - Intergenic
1196856537 X:119990493-119990515 GCCAGCACTGCTCTCCCCTCTGG - Intergenic
1197626373 X:128806842-128806864 CCCAGCTCTGCTGCACTTTCAGG + Intergenic
1197730478 X:129805262-129805284 CCCAGCACTGCTGCCCTCTCGGG - Exonic
1199226646 X:145383750-145383772 CCCAAAGCTGCTTTCCTTTCTGG + Intergenic
1199258259 X:145742622-145742644 CCCAGCTCTTGTCTCCTTTCAGG + Intergenic
1199574824 X:149303733-149303755 CCCAGCACTGATCTGCTATCTGG - Intergenic
1200234692 X:154462585-154462607 CCCAGGCCTGCTCTCGTGGCAGG - Intronic
1201054588 Y:9976050-9976072 CCCATCCCTGCTAATCTTTCAGG + Intergenic
1201912718 Y:19149595-19149617 CATAGCACTGCTCTGCTTTCTGG - Intergenic
1202081279 Y:21086615-21086637 CCCAACGCTGCTCTCCAGTCTGG + Intergenic
1202593044 Y:26507636-26507658 TCCGTCCCTGCTGTCCTTTCCGG - Intergenic