ID: 1076704766

View in Genome Browser
Species Human (GRCh38)
Location 10:132295090-132295112
Sequence CAGTGCACAGAGCAGGTGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076704759_1076704766 11 Left 1076704759 10:132295056-132295078 CCAAAGGAGGCCTGTCAATTCAC 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG No data
1076704760_1076704766 1 Left 1076704760 10:132295066-132295088 CCTGTCAATTCACACGCCCACCG 0: 1
1: 0
2: 0
3: 3
4: 39
Right 1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG No data
1076704754_1076704766 27 Left 1076704754 10:132295040-132295062 CCCAGAGAAACAGCCTCCAAAGG 0: 1
1: 1
2: 1
3: 30
4: 391
Right 1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG No data
1076704758_1076704766 14 Left 1076704758 10:132295053-132295075 CCTCCAAAGGAGGCCTGTCAATT 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG No data
1076704756_1076704766 26 Left 1076704756 10:132295041-132295063 CCAGAGAAACAGCCTCCAAAGGA 0: 1
1: 0
2: 0
3: 31
4: 369
Right 1076704766 10:132295090-132295112 CAGTGCACAGAGCAGGTGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076704766 Original CRISPR CAGTGCACAGAGCAGGTGCA CGG Intronic
No off target data available for this crispr