ID: 1076704962

View in Genome Browser
Species Human (GRCh38)
Location 10:132296395-132296417
Sequence CTAGTTACGACAAATGTACC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076704956_1076704962 21 Left 1076704956 10:132296351-132296373 CCAGTGTGGACTTCAGTTCACAA 0: 1
1: 0
2: 1
3: 10
4: 109
Right 1076704962 10:132296395-132296417 CTAGTTACGACAAATGTACCCGG No data
1076704955_1076704962 22 Left 1076704955 10:132296350-132296372 CCCAGTGTGGACTTCAGTTCACA 0: 1
1: 0
2: 1
3: 32
4: 136
Right 1076704962 10:132296395-132296417 CTAGTTACGACAAATGTACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076704962 Original CRISPR CTAGTTACGACAAATGTACC CGG Intronic
No off target data available for this crispr