ID: 1076705828

View in Genome Browser
Species Human (GRCh38)
Location 10:132301152-132301174
Sequence TTCTGGGCTCATATTAATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076705828_1076705832 10 Left 1076705828 10:132301152-132301174 CCTCCATTAATATGAGCCCAGAA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1076705832 10:132301185-132301207 GCTTCCCAACACCAAGTAGAAGG No data
1076705828_1076705835 15 Left 1076705828 10:132301152-132301174 CCTCCATTAATATGAGCCCAGAA 0: 1
1: 0
2: 0
3: 4
4: 89
Right 1076705835 10:132301190-132301212 CCAACACCAAGTAGAAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076705828 Original CRISPR TTCTGGGCTCATATTAATGG AGG (reversed) Intronic
902164527 1:14559511-14559533 TTCTGGTCTCATTTTAAAGATGG - Intergenic
906776725 1:48536529-48536551 TTGTGTGCTCAGATTTATGGAGG - Intronic
909915606 1:81314463-81314485 TTCTGAGCTGATATTACTGAGGG - Intronic
918378665 1:183933669-183933691 GTCTGGGCTCTTACTAGTGGGGG - Intronic
919657958 1:200215586-200215608 TACTGGGCTCATAGTTCTGGAGG - Intergenic
923107108 1:230863226-230863248 TTCTGGATTCGTATTCATGGTGG - Intronic
1063134735 10:3206779-3206801 TTCTGGGCACATGTTACTGGTGG + Intergenic
1063289118 10:4723088-4723110 CTTTGGGCCCAGATTAATGGAGG - Intergenic
1063562018 10:7137404-7137426 TTCAGTGATCATTTTAATGGAGG - Intergenic
1065410155 10:25417320-25417342 TTCTTGGCTGATGTTAATGCAGG + Intronic
1076705828 10:132301152-132301174 TTCTGGGCTCATATTAATGGAGG - Intronic
1076705851 10:132301276-132301298 ATCTGGGTTCACATTAGTGGAGG - Intronic
1080391597 11:31852698-31852720 TACTGAGCTCATATTTATAGTGG + Intronic
1083834950 11:65260550-65260572 TCCTGGGCTCAAGTTAAGGGAGG + Intergenic
1084205517 11:67589558-67589580 TTCTGGGCTCATTTAAATCCAGG + Intergenic
1090959029 11:131539452-131539474 TTATGGGATGATATTAATTGGGG + Intronic
1093261970 12:16950103-16950125 TCTTGGGCTCAGATTAATGAGGG + Intergenic
1094589430 12:31806621-31806643 TTCTGTGTTGATATTAATGCCGG - Intergenic
1098480012 12:70946737-70946759 TTCTGGGAACATATTAAAGTAGG - Intergenic
1100026702 12:90137999-90138021 TTTTGGTATCATAATAATGGTGG + Intergenic
1100745850 12:97644897-97644919 TCGTGGACTCATATTAATGCTGG - Intergenic
1104046201 12:125164775-125164797 TTGGGAGCTCATATCAATGGTGG + Intergenic
1106169935 13:27280243-27280265 TTCTGGGCTCATATGACTTTAGG - Intergenic
1107275974 13:38679776-38679798 TTCTGGGCTCAGCTGAGTGGTGG + Intergenic
1107651235 13:42547287-42547309 TTCTGGGCTCACAGTAGTGCTGG + Intergenic
1109167731 13:59056810-59056832 TTCTGGACTCATATCCATGCTGG - Intergenic
1109706425 13:66099194-66099216 CTCTAGGCTCATATTGAAGGAGG + Intergenic
1109889938 13:68598005-68598027 TTCTGGTCCCATGTTTATGGTGG - Intergenic
1114162885 14:20188905-20188927 TTCTGATCTCTTTTTAATGGTGG - Intergenic
1116965053 14:51005501-51005523 TTCTGGGTTAATATTTATTGGGG + Intronic
1126536422 15:49770382-49770404 TTCTGAGGTCAGAGTAATGGAGG + Intergenic
1127252620 15:57256644-57256666 TTTTGGGCTCCTAATAATGGAGG + Intronic
1127521019 15:59743011-59743033 TTCTGTGCTTATGTTAAGGGTGG - Intergenic
1129063892 15:72884661-72884683 TACTGAGCTCATAAAAATGGAGG - Intergenic
1129981535 15:79876275-79876297 TTCTTGGCTCATATTCATAATGG - Intronic
1134412083 16:14011557-14011579 TTCTGTGCTCTTATTAATTTAGG - Intergenic
1135195192 16:20388480-20388502 TTCTTGGAGCAGATTAATGGGGG + Intronic
1139713326 16:68792963-68792985 TTCTGGGCACATATGTTTGGGGG + Intronic
1141623338 16:85248739-85248761 TTCTGAGCTGGTATCAATGGGGG - Intergenic
1145229699 17:21164437-21164459 TTCTGACCTCATATTTATGTTGG + Intronic
1146961062 17:36979580-36979602 ATCTGGGGTAATATGAATGGGGG + Intronic
1147337241 17:39734571-39734593 TCCTGGCCTCTTATTAATGGTGG + Intergenic
927618268 2:24622783-24622805 TTCTTGGCTCATTTTTCTGGGGG + Intronic
927630711 2:24771604-24771626 TTCTGAAGTCATATTTATGGGGG + Intergenic
928210664 2:29321279-29321301 TCCTGGGGTCACATTCATGGTGG - Intronic
931859191 2:66335836-66335858 TTCTGTTCTCATATTAACGTGGG - Intergenic
932857002 2:75245432-75245454 TTCCAAGCTCATATTACTGGTGG + Intergenic
933008930 2:77032064-77032086 TTCTAGGCCCAAGTTAATGGTGG - Intronic
940027077 2:149219626-149219648 TTCTTGGCTTACATTACTGGAGG + Intergenic
941557192 2:166996003-166996025 TTCAAGACTCATATAAATGGAGG - Intronic
943107302 2:183561426-183561448 TTTTTGGCTCATATTTTTGGAGG + Intergenic
946157364 2:217815771-217815793 TTCTGCCCTCATCTTCATGGTGG - Intronic
1172188961 20:33050064-33050086 AAATGGGCTCATATTAAAGGTGG - Intergenic
1172426790 20:34860963-34860985 TTCAGAGCTCAGAGTAATGGTGG - Intronic
1173775862 20:45705762-45705784 TCATGGTCTAATATTAATGGTGG + Intronic
1178031187 21:28527925-28527947 TGCTGGGCTCTTGTTAAAGGTGG - Intergenic
1178472170 21:32903660-32903682 TTCTGGGCTAGTAATCATGGTGG + Intergenic
1182565793 22:31198057-31198079 TTCTGGGCTCTTGGCAATGGTGG - Intronic
950138802 3:10601304-10601326 TCCTGGGCCCATAATAAGGGGGG + Intronic
954737922 3:52722107-52722129 TTATGGGCTCAGAATAAGGGAGG - Intronic
961724245 3:128915554-128915576 TTCTTGGCTCCTAGAAATGGGGG + Exonic
962958181 3:140285742-140285764 TTCTGGGCTAAAATAAAGGGTGG + Intronic
966568416 3:181410115-181410137 TTCTGCGCTCACAGGAATGGAGG + Intergenic
978897963 4:113912829-113912851 TTCTGGGAACATAATAATTGTGG + Intronic
980407001 4:132366422-132366444 TTCTGGGGTCAGAATGATGGTGG + Intergenic
981137106 4:141222913-141222935 TTCTGGGCTGCTTTGAATGGTGG + Intronic
983404615 4:167312298-167312320 TTTTGGCTTCATATTAATGTTGG - Intergenic
984805571 4:183748348-183748370 TTCTAGGCTAATATTTATGTGGG + Intergenic
984993002 4:185399474-185399496 TTTTGGGCTCATACAAATGTTGG - Intronic
990525438 5:56621590-56621612 TTGTGGGCTGATTTTTATGGAGG + Intergenic
993448995 5:88051210-88051232 TTCTGTGCTCATCTTTGTGGTGG - Intergenic
994749785 5:103723093-103723115 TTATGACCTCATATTCATGGGGG + Intergenic
995674638 5:114649647-114649669 TTCTGGGCTCAGTTAAAAGGGGG + Intergenic
1001604173 5:172948182-172948204 TCCTGGGCTGTTATTACTGGAGG + Intronic
1004394394 6:15235434-15235456 TTCTGGGACCAAATGAATGGAGG + Intergenic
1012432399 6:99178391-99178413 TTCTGTGTTCATGTTAATGCTGG - Intergenic
1012631239 6:101470247-101470269 TTCTGGGATCTCCTTAATGGTGG + Intronic
1014755678 6:125299925-125299947 TTCTTGGTTGATCTTAATGGAGG - Intronic
1023767855 7:43528711-43528733 TGCAGGGCAGATATTAATGGAGG + Intronic
1037048407 8:14338261-14338283 TTCTGGTCTCATTTCAATGAAGG + Intronic
1043308480 8:78827715-78827737 TTCTGGTATCAGAATAATGGTGG - Intergenic
1047927855 8:129698499-129698521 TTCTGGGCTTTCATCAATGGTGG - Intergenic
1049855970 8:144862130-144862152 TTCTGGACTCATTTTACAGGGGG + Intergenic
1050458984 9:5861001-5861023 GTATGGGCTCATAGTACTGGAGG - Intergenic
1052424748 9:28290229-28290251 TTCTAGGCTAATATTTATGTGGG + Intronic
1058222859 9:102324614-102324636 TTCTGCATTTATATTAATGGGGG - Intergenic
1062043178 9:134413524-134413546 TTCTGGCCTCCTCTTAAGGGTGG - Intronic
1186245911 X:7616687-7616709 TTCTTGGCTCACATTTACGGAGG - Intergenic
1186302290 X:8213274-8213296 TCATAGGCTCATATTAATGGAGG + Intergenic
1188111766 X:26202483-26202505 TTCTGGTTTCATATGAATGTTGG - Intergenic
1190730079 X:53220112-53220134 TTGTGGGTACATAATAATGGGGG + Intronic
1195114715 X:101685643-101685665 TTTTGTGCTTATATTTATGGGGG + Intergenic
1196523370 X:116700864-116700886 TTCTGAGCTCATTTTTATGAAGG + Intergenic
1199653344 X:149970085-149970107 CTCTGGGCTCAAATTCCTGGGGG + Intergenic