ID: 1076705967

View in Genome Browser
Species Human (GRCh38)
Location 10:132301750-132301772
Sequence GGACTGAGAGGAACAGAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076705962_1076705967 7 Left 1076705962 10:132301720-132301742 CCACGTGTGGAGAAGGCTGGGCC 0: 1
1: 0
2: 1
3: 20
4: 182
Right 1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG No data
1076705957_1076705967 25 Left 1076705957 10:132301702-132301724 CCAGGAGCTGCACGTCGGCCACG 0: 1
1: 0
2: 0
3: 5
4: 127
Right 1076705967 10:132301750-132301772 GGACTGAGAGGAACAGAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076705967 Original CRISPR GGACTGAGAGGAACAGAAGG AGG Intronic
No off target data available for this crispr