ID: 1076712578

View in Genome Browser
Species Human (GRCh38)
Location 10:132346749-132346771
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712578_1076712588 29 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712578_1076712586 27 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712586 10:132346799-132346821 TTCTAGTCACTTGTACCCCAGGG No data
1076712578_1076712587 28 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712587 10:132346800-132346822 TCTAGTCACTTGTACCCCAGGGG No data
1076712578_1076712585 26 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1076712578_1076712583 -10 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712583 10:132346762-132346784 TCAGTTGTCCACAGGCAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076712578 Original CRISPR GGACAACTGATTTAGGGCCA GGG (reversed) Intronic