ID: 1076712579

View in Genome Browser
Species Human (GRCh38)
Location 10:132346750-132346772
Sequence TGGACAACTGATTTAGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712579_1076712587 27 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA No data
Right 1076712587 10:132346800-132346822 TCTAGTCACTTGTACCCCAGGGG No data
1076712579_1076712588 28 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA No data
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712579_1076712585 25 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data
1076712579_1076712586 26 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA No data
Right 1076712586 10:132346799-132346821 TTCTAGTCACTTGTACCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076712579 Original CRISPR TGGACAACTGATTTAGGGCC AGG (reversed) Intronic