ID: 1076712579 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:132346750-132346772 |
| Sequence | TGGACAACTGATTTAGGGCC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1076712579_1076712587 | 27 | Left | 1076712579 | 10:132346750-132346772 | CCTGGCCCTAAATCAGTTGTCCA | No data | ||
| Right | 1076712587 | 10:132346800-132346822 | TCTAGTCACTTGTACCCCAGGGG | No data | ||||
| 1076712579_1076712585 | 25 | Left | 1076712579 | 10:132346750-132346772 | CCTGGCCCTAAATCAGTTGTCCA | No data | ||
| Right | 1076712585 | 10:132346798-132346820 | TTTCTAGTCACTTGTACCCCAGG | 0: 1 1: 0 2: 0 3: 4 4: 110 |
||||
| 1076712579_1076712586 | 26 | Left | 1076712579 | 10:132346750-132346772 | CCTGGCCCTAAATCAGTTGTCCA | No data | ||
| Right | 1076712586 | 10:132346799-132346821 | TTCTAGTCACTTGTACCCCAGGG | No data | ||||
| 1076712579_1076712588 | 28 | Left | 1076712579 | 10:132346750-132346772 | CCTGGCCCTAAATCAGTTGTCCA | No data | ||
| Right | 1076712588 | 10:132346801-132346823 | CTAGTCACTTGTACCCCAGGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1076712579 | Original CRISPR | TGGACAACTGATTTAGGGCC AGG (reversed) | Intronic | ||