ID: 1076712581

View in Genome Browser
Species Human (GRCh38)
Location 10:132346755-132346777
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712581_1076712585 20 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG 0: 1
1: 0
2: 0
3: 4
4: 110
1076712581_1076712586 21 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC No data
Right 1076712586 10:132346799-132346821 TTCTAGTCACTTGTACCCCAGGG No data
1076712581_1076712588 23 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC No data
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712581_1076712587 22 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC No data
Right 1076712587 10:132346800-132346822 TCTAGTCACTTGTACCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076712581 Original CRISPR GCCTGTGGACAACTGATTTA GGG (reversed) Intronic