ID: 1076712585

View in Genome Browser
Species Human (GRCh38)
Location 10:132346798-132346820
Sequence TTTCTAGTCACTTGTACCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712581_1076712585 20 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data
1076712582_1076712585 19 Left 1076712582 10:132346756-132346778 CCTAAATCAGTTGTCCACAGGCA No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data
1076712578_1076712585 26 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data
1076712584_1076712585 5 Left 1076712584 10:132346770-132346792 CCACAGGCAGATTGGTCAAATAT No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data
1076712579_1076712585 25 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA No data
Right 1076712585 10:132346798-132346820 TTTCTAGTCACTTGTACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076712585 Original CRISPR TTTCTAGTCACTTGTACCCC AGG Intronic