ID: 1076712588

View in Genome Browser
Species Human (GRCh38)
Location 10:132346801-132346823
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712578_1076712588 29 Left 1076712578 10:132346749-132346771 CCCTGGCCCTAAATCAGTTGTCC 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712584_1076712588 8 Left 1076712584 10:132346770-132346792 CCACAGGCAGATTGGTCAAATAT 0: 1
1: 0
2: 1
3: 10
4: 140
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712581_1076712588 23 Left 1076712581 10:132346755-132346777 CCCTAAATCAGTTGTCCACAGGC 0: 1
1: 0
2: 0
3: 4
4: 115
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712579_1076712588 28 Left 1076712579 10:132346750-132346772 CCTGGCCCTAAATCAGTTGTCCA 0: 1
1: 0
2: 1
3: 9
4: 123
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data
1076712582_1076712588 22 Left 1076712582 10:132346756-132346778 CCTAAATCAGTTGTCCACAGGCA 0: 1
1: 0
2: 1
3: 13
4: 144
Right 1076712588 10:132346801-132346823 CTAGTCACTTGTACCCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr