ID: 1076712592 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:132346820-132346842 |
Sequence | GGGGAATTTTACAACTTCTT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1076712584_1076712592 | 27 | Left | 1076712584 | 10:132346770-132346792 | CCACAGGCAGATTGGTCAAATAT | No data | ||
Right | 1076712592 | 10:132346820-132346842 | GGGGAATTTTACAACTTCTTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1076712592 | Original CRISPR | GGGGAATTTTACAACTTCTT AGG | Intronic | ||