ID: 1076712592

View in Genome Browser
Species Human (GRCh38)
Location 10:132346820-132346842
Sequence GGGGAATTTTACAACTTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076712584_1076712592 27 Left 1076712584 10:132346770-132346792 CCACAGGCAGATTGGTCAAATAT No data
Right 1076712592 10:132346820-132346842 GGGGAATTTTACAACTTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076712592 Original CRISPR GGGGAATTTTACAACTTCTT AGG Intronic