ID: 1076713896

View in Genome Browser
Species Human (GRCh38)
Location 10:132353713-132353735
Sequence GGGCCCAGGGAGCACCGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076713886_1076713896 10 Left 1076713886 10:132353680-132353702 CCAGGTCTTGCTGGCCACGGGCC 0: 1
1: 0
2: 1
3: 15
4: 166
Right 1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG No data
1076713882_1076713896 24 Left 1076713882 10:132353666-132353688 CCATCGCTGTGGGACCAGGTCTT 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG No data
1076713890_1076713896 -4 Left 1076713890 10:132353694-132353716 CCACGGGCCACAGCTGCTGGGGC 0: 1
1: 0
2: 1
3: 38
4: 376
Right 1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG No data
1076713881_1076713896 25 Left 1076713881 10:132353665-132353687 CCCATCGCTGTGGGACCAGGTCT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1076713896 10:132353713-132353735 GGGCCCAGGGAGCACCGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076713896 Original CRISPR GGGCCCAGGGAGCACCGGGA AGG Intronic
No off target data available for this crispr