ID: 1076717019

View in Genome Browser
Species Human (GRCh38)
Location 10:132371304-132371326
Sequence CAAGCTCCTGGCTCATGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 207}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076717019_1076717027 5 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717027 10:132371332-132371354 GATTAGAGGACCAGGGTGGACGG No data
1076717019_1076717028 6 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717028 10:132371333-132371355 ATTAGAGGACCAGGGTGGACGGG No data
1076717019_1076717025 -2 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717025 10:132371325-132371347 TGCATGTGATTAGAGGACCAGGG No data
1076717019_1076717023 -9 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717023 10:132371318-132371340 AGGAGCTTGCATGTGATTAGAGG No data
1076717019_1076717026 1 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717026 10:132371328-132371350 ATGTGATTAGAGGACCAGGGTGG No data
1076717019_1076717024 -3 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717024 10:132371324-132371346 TTGCATGTGATTAGAGGACCAGG No data
1076717019_1076717030 12 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717030 10:132371339-132371361 GGACCAGGGTGGACGGGTCAGGG No data
1076717019_1076717029 11 Left 1076717019 10:132371304-132371326 CCAGCCCATGAGCCAGGAGCTTG 0: 1
1: 0
2: 0
3: 24
4: 207
Right 1076717029 10:132371338-132371360 AGGACCAGGGTGGACGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076717019 Original CRISPR CAAGCTCCTGGCTCATGGGC TGG (reversed) Intronic
900310871 1:2032585-2032607 CAGGCTCCTGCCCCAAGGGCGGG + Intergenic
900362267 1:2294793-2294815 CAGTCTCCTGGCACCTGGGCTGG + Intronic
900558756 1:3293118-3293140 CCAGCTCCTGGCACTTGGCCGGG + Intronic
900796832 1:4713063-4713085 CAAGCATCTTGCTCAAGGGCCGG - Intronic
901468857 1:9441641-9441663 CAGGCTCTTGGCTCAGGCGCCGG - Intergenic
904369518 1:30039759-30039781 CCAGCTCCTGGATCCTGGCCTGG - Intergenic
904400915 1:30256123-30256145 CAAGCCCCTGGCACAGGGTCCGG - Intergenic
904754376 1:32760132-32760154 CAGCATTCTGGCTCATGGGCTGG + Intronic
905344680 1:37303219-37303241 CCAGGGCCTGGCTCATGCGCCGG - Intergenic
905378103 1:37538778-37538800 CCAGCTCCTGGGCCATGGACTGG + Intronic
905500858 1:38435162-38435184 CTAGCTCCTGGCACAGGGCCTGG - Intergenic
906146397 1:43563256-43563278 CAGGTTCCTGGCTCTGGGGCTGG + Intronic
908938211 1:69400922-69400944 CACACTCCTGGCACTTGGGCTGG + Intergenic
915592598 1:156879140-156879162 CAAGCTGCTGGCTGGTGGGGAGG + Exonic
917233829 1:172868155-172868177 CAAGCTGCTGGGTGATGAGCAGG + Intergenic
917985115 1:180308657-180308679 GAAGGTCCTGGCTCATGTGCAGG + Intronic
1063895972 10:10682483-10682505 CAAGCTCTTACCTGATGGGCCGG - Intergenic
1064615605 10:17152619-17152641 CCAGTACCTGGCTGATGGGCTGG - Intronic
1065830412 10:29609414-29609436 CTGGCCCGTGGCTCATGGGCTGG - Intronic
1065838560 10:29681000-29681022 CAAACAACTGGCTCAGGGGCAGG + Intronic
1067015785 10:42755486-42755508 TAAGCCCCTGTCTCATAGGCTGG + Intergenic
1067704634 10:48597815-48597837 TAAGCTAATGGCTCATAGGCAGG - Intronic
1067794412 10:49310344-49310366 CCCGCTTATGGCTCATGGGCTGG - Intronic
1069068760 10:63973479-63973501 CAAACTCCTGCCTCAGAGGCAGG + Intergenic
1071973996 10:90936907-90936929 CAAGTACCTGCCTCATGGCCAGG + Intergenic
1074531588 10:114302158-114302180 TCAGCTCCTGGCTCTTGGCCGGG + Intronic
1075087166 10:119421476-119421498 CAGGCTCCTGGCTCTTGGCCTGG + Intronic
1075533344 10:123249108-123249130 CGAGCACCAGGCTCATTGGCTGG - Intergenic
1075672812 10:124275093-124275115 CTACATCCTGGCTCATGGCCTGG + Intergenic
1076297052 10:129394075-129394097 AAAAGTCCTGGCTCAAGGGCAGG + Intergenic
1076717019 10:132371304-132371326 CAAGCTCCTGGCTCATGGGCTGG - Intronic
1077275810 11:1707182-1707204 CTTGCTTCTGGCTCATAGGCTGG - Intergenic
1078115367 11:8443883-8443905 CTTGCTCCTGGCTCCTGGGGAGG + Intronic
1078131830 11:8619872-8619894 CACGCTCCTGCCCCATGGCCTGG + Intronic
1079140585 11:17806913-17806935 CAAAGTCCTGGCTCAGGGGTGGG - Intronic
1079313449 11:19387422-19387444 CAGGCTGCTGGAGCATGGGCTGG + Intronic
1083663361 11:64262294-64262316 CAAGGTCCAGGGTCAGGGGCGGG - Intronic
1083935912 11:65870081-65870103 CAGGCTCCTGGGTCCTGGGCAGG - Intronic
1084270950 11:68028867-68028889 CAAGCTCCTCTGGCATGGGCTGG - Exonic
1084408789 11:68994170-68994192 AAAGCTCCTCTCTCATGGTCGGG - Intergenic
1084457716 11:69277992-69278014 CCAGCTGCTGGCTCATGGGTGGG + Intergenic
1084950554 11:72662932-72662954 CAGGTTCATGGCTCCTGGGCTGG - Intronic
1090608474 11:128449408-128449430 CAAGCTCCAGGCTCAGTGGGGGG + Intergenic
1095609023 12:44105683-44105705 CAACCTCCTGGCCCCTGGGTGGG + Intronic
1096522894 12:52194129-52194151 CAAGTCCCTGGCTCCTAGGCTGG + Intergenic
1098753112 12:74321541-74321563 CCAGCACGTGGCTCCTGGGCTGG + Intergenic
1101604723 12:106239500-106239522 CGTGCTCCTGGCTCTTGGACAGG + Exonic
1103039040 12:117679543-117679565 CAGACTCCTGCCTCATGGCCAGG - Intronic
1103483768 12:121268794-121268816 CAAGCTCCTGGCCCCCTGGCAGG + Intronic
1104786443 12:131452718-131452740 CCAGCTCCTGATTCATGTGCAGG - Intergenic
1104890867 12:132139480-132139502 CGAGCTTCTGGCCCAAGGGCGGG - Intronic
1105854208 13:24360868-24360890 CAAACCCCTGGCTCCTGGGGTGG - Intergenic
1106199369 13:27523688-27523710 CACGCTCCAGCCTCATGGGAAGG - Intergenic
1106614105 13:31310605-31310627 CCAGCCCGTGGCTCCTGGGCTGG - Intronic
1107337885 13:39374868-39374890 CCAGCACCTAGCCCATGGGCTGG + Intronic
1107703090 13:43069323-43069345 CAAGCTCCTGGCACAGGGATGGG - Intronic
1109008558 13:56910012-56910034 CAGGCTCATGGCTCCTGGGCTGG - Intergenic
1110678720 13:78282603-78282625 CCAGTTCCTGGCCCATGGGAGGG - Intergenic
1111227352 13:85291049-85291071 CAGGTTCATGGCTCATGGCCGGG - Intergenic
1113076877 13:106475472-106475494 CATGCTCCTGGCTTAGGAGCCGG + Intergenic
1113229396 13:108195601-108195623 CCAGCTCATAGCTCCTGGGCTGG - Intergenic
1114184594 14:20390937-20390959 CAAGCTCCAGGCTCAAGTCCAGG - Exonic
1115431029 14:33319060-33319082 CATTCACCTGGCACATGGGCTGG + Intronic
1121676184 14:95754882-95754904 CAAGCTCCTGGCAGATGAACAGG - Intergenic
1121965489 14:98299916-98299938 CAATTTCCTGGCTCTTAGGCTGG - Intergenic
1122079152 14:99254729-99254751 CACGCTCCTGGCCCCCGGGCCGG - Intronic
1122843005 14:104475889-104475911 CAAACCCCTGGCTCCTGGGGTGG - Intronic
1202834064 14_GL000009v2_random:64862-64884 CAATTCACTGGCTCATGGGCAGG + Intergenic
1126180851 15:45783808-45783830 CAAGCTCCTGTCTCTGTGGCCGG - Intergenic
1126731391 15:51686770-51686792 AGGGCTCATGGCTCATGGGCTGG + Intronic
1126799813 15:52288730-52288752 CAGACTCCTGCCTCATGGGAAGG - Intronic
1126955142 15:53925406-53925428 CAAGCCTCTGGCTCATGGGAAGG - Intergenic
1128978341 15:72169070-72169092 CAAGCTTCTGGCTCAAGGCCAGG - Intronic
1131874478 15:96790157-96790179 CAAGCTCATGTGTCATGGGCAGG + Intergenic
1132611991 16:821824-821846 CCAGCTCCTGGCTGGTCGGCAGG - Intergenic
1133270112 16:4607075-4607097 CAAGCTCCTGGCTGATGCTGGGG + Intergenic
1134014444 16:10878710-10878732 CTAGCTCCTGGCTCCTGGCCCGG + Intronic
1137775321 16:51049182-51049204 CCAGCCCCTGGGTCATGTGCAGG - Intergenic
1139144577 16:64308273-64308295 CTAGCCCCTGGGCCATGGGCTGG + Intergenic
1139952247 16:70678116-70678138 CATGCTCCTGGCCCAAAGGCAGG - Intronic
1141089667 16:81121555-81121577 CATGCTCATAGCTCATGAGCAGG - Intergenic
1141362787 16:83412060-83412082 CAAGCTCATGGCTCTATGGCTGG + Intronic
1141511582 16:84515498-84515520 CATGGGCCTGGCCCATGGGCGGG - Intronic
1141594580 16:85089484-85089506 CAGGCCCCGGGCCCATGGGCTGG - Exonic
1142717624 17:1755626-1755648 CCAGCTCCTGGCAGAGGGGCTGG - Intergenic
1143187147 17:5017153-5017175 GTAGCTCCTTGCCCATGGGCTGG - Intronic
1143457311 17:7076626-7076648 CAAGCTGCTGGCTGAAGGGGAGG + Intronic
1143585486 17:7848352-7848374 CAAGATCCTACCTGATGGGCTGG + Exonic
1143908474 17:10228252-10228274 CAAGCGCCTGGCTCAGTAGCAGG - Intergenic
1146399885 17:32494188-32494210 CTGGCTCCTGGCTGAGGGGCTGG + Exonic
1148524413 17:48317005-48317027 CCAGCCCCTGGATCATGGGCAGG + Intronic
1148779711 17:50114416-50114438 CCAGCTCCTGGCTCATGCACAGG - Exonic
1150694833 17:67395797-67395819 CAAACTCCTGGCACTTGGGTGGG - Intronic
1151875441 17:76865589-76865611 CAAGATCCTGCCTCATCGACTGG - Intergenic
1152235779 17:79137621-79137643 CAAGCTGCTGGCGCCTGGCCTGG + Intronic
1152773303 17:82184221-82184243 CAAGAACCTGGCACATGGCCTGG - Intronic
1157283611 18:46362116-46362138 CAAGCTCTGGGCTTAGGGGCAGG + Intronic
1157411506 18:47466706-47466728 CAAGGTCATGCCTCATGGGGTGG + Intergenic
1158634978 18:59148373-59148395 CAAGGTGTTGGCACATGGGCAGG + Intronic
1159580983 18:70234612-70234634 CCTCCTCCTGTCTCATGGGCTGG - Intergenic
1159939041 18:74392027-74392049 CATGATCCAGGCTCTTGGGCTGG + Intergenic
1161068890 19:2250812-2250834 CACGCGGCTGGCTCAGGGGCTGG - Intronic
1161611573 19:5245995-5246017 TGATCTCGTGGCTCATGGGCAGG + Exonic
1161953350 19:7479534-7479556 CAACCTCCTGGCTGATGCTCCGG + Intronic
1162737324 19:12753821-12753843 GAAGTTCCTGGCTCAGGGGCCGG + Intronic
1162924506 19:13923471-13923493 CACGCTCCTGGGGGATGGGCTGG - Intronic
1164593504 19:29519151-29519173 CAAGATCCTGCCTCACGGCCTGG - Intergenic
1165772428 19:38387120-38387142 CATGCGCCTGACTCGTGGGCTGG - Exonic
1166342137 19:42144523-42144545 CTAGCTCCTGGCACAAGGTCTGG - Intronic
1166355573 19:42225357-42225379 CCGGCTGCAGGCTCATGGGCGGG + Exonic
1166546411 19:43636765-43636787 CAGGCGCCTGGCTCATGGGTGGG + Intronic
1166651691 19:44579981-44580003 CAAGCTCCTGGAGCAGGGCCTGG + Intergenic
1168563522 19:57403662-57403684 CCAGCCCATGGCTCATGGGCTGG - Intronic
925422008 2:3719974-3719996 CAAACCCCTGGCACACGGGCTGG - Intronic
925428723 2:3772818-3772840 AGAGCCCCTGGCTTATGGGCAGG + Intronic
926358827 2:12066131-12066153 CAAGTGTCTGGCCCATGGGCAGG + Intergenic
927246670 2:20962201-20962223 GATGCTCATGGCTCAGGGGCTGG - Intergenic
927400440 2:22704289-22704311 AAGGCTGCTGGCTCAGGGGCTGG - Intergenic
927849278 2:26488806-26488828 CAGACTCCTGCCTCCTGGGCTGG - Intronic
930635054 2:53795237-53795259 CAGCCTCCTGGCTCCTAGGCCGG - Intronic
933943266 2:87262921-87262943 CCAGCTCCTGGCACCTGGCCTGG - Intergenic
934520881 2:95019409-95019431 GCAGCACCTGGCCCATGGGCAGG - Intergenic
934573261 2:95385035-95385057 CAAGCTGCTGGGCCATGGGAGGG - Exonic
935028067 2:99296356-99296378 CAAGAAGCTGGCTCATGGGCAGG + Intronic
935606155 2:104974085-104974107 CAAGATCCAGGCTCAAGGACAGG - Intergenic
936336948 2:111598640-111598662 CCAGCTCCTGGCACCTGGCCTGG + Intergenic
937646426 2:124270464-124270486 AAAGCTCCTAGGTCAGGGGCTGG + Intronic
939692661 2:145284767-145284789 AAAGGGCCTGGCTCATGGGTCGG + Intergenic
940353613 2:152716987-152717009 GAAGGTGCTGGCTCTTGGGCGGG - Intronic
941964240 2:171284786-171284808 CTACCTCCTGCCTCAAGGGCAGG + Intergenic
946875707 2:224127612-224127634 CAAACTTCTGGTTCATGGGTAGG - Intergenic
947498985 2:230658749-230658771 GAAGCTGGTGGCTCATGTGCAGG - Intergenic
948512207 2:238476222-238476244 CCAGCTCCTAGCACAGGGGCAGG - Intergenic
948773765 2:240269410-240269432 CCAGCTCCTTGCTCCTGGTCAGG + Intergenic
948791433 2:240379422-240379444 CACGCTCCAGGCACATGGCCTGG + Intergenic
1169339285 20:4783922-4783944 CAAGCTCACGGCTCTTGTGCTGG + Exonic
1170959453 20:21012234-21012256 CAAGATCCAGTTTCATGGGCGGG - Intergenic
1171381400 20:24737043-24737065 CCAGTTCCTGGCCCTTGGGCTGG + Intergenic
1174572206 20:51509870-51509892 CAGGCTACTGCCTCCTGGGCTGG - Intronic
1174988428 20:55481952-55481974 CATTCTCCTGCCTCATTGGCTGG - Intergenic
1175264272 20:57693108-57693130 ACAGCTCCTGGCTGCTGGGCAGG - Intronic
1175517070 20:59576742-59576764 CAGGATCCTGCCTCAAGGGCAGG + Intergenic
1175739690 20:61412002-61412024 CTTGATCCTGGCTCAAGGGCAGG - Intronic
1176108018 20:63398718-63398740 CTGGCTCCTGGCTCCTGGGTGGG - Intergenic
1176162762 20:63656757-63656779 TAAACTCCTGGCTCCTGAGCAGG + Intergenic
1176372930 21:6073462-6073484 CAGGCTCCGCGCTCATGGCCTGG + Intergenic
1178915073 21:36701458-36701480 CCCGCGCCTGGCTCCTGGGCCGG - Intronic
1179750547 21:43464781-43464803 CAGGCTCCGCGCTCATGGCCTGG - Intergenic
1181462662 22:23094680-23094702 CTATCTGCTGGCTCCTGGGCTGG + Intronic
1182115417 22:27753582-27753604 AAGGCTCCTGTTTCATGGGCAGG - Intronic
1182373741 22:29830758-29830780 CCAGCACCTGGCACATGGCCTGG + Intronic
1183467949 22:37989498-37989520 CAAGCTCCTCTGTCATGGGTGGG + Intronic
1184554740 22:45227057-45227079 CTGGCTCCTGGCTCAGGGCCCGG - Intronic
1184993835 22:48188224-48188246 CACCCACCTGGCTCGTGGGCTGG - Intergenic
1185047926 22:48538226-48538248 CCAGCTCCTGGTTTAGGGGCGGG + Intronic
1185049898 22:48548549-48548571 CAGGCTCCAGGCTCTGGGGCAGG + Intronic
949761742 3:7478635-7478657 TAAGTTACTGGATCATGGGCAGG + Intronic
953251278 3:41247384-41247406 AAAGCTCCTGGCTGATTGGCTGG - Intronic
954624147 3:52013293-52013315 CAAGCTCCTGGCATATGGTGTGG - Intergenic
954758082 3:52853380-52853402 CATGCTCCTGTCACATGGGTCGG - Intronic
957681026 3:83435337-83435359 CCAGCTCCAGGCTCCTGGGCCGG + Intergenic
960139749 3:114140514-114140536 AAAGCTCTTGGCTCATCGCCTGG - Intronic
961111805 3:124290525-124290547 GAAGCTCCGGGCTCATTGGAGGG + Intronic
966254267 3:177899509-177899531 CAGGCTCCCAGCTCCTGGGCTGG - Intergenic
967905254 3:194494200-194494222 GAAGGTCCTGGCTCATGAGGAGG - Exonic
968187391 3:196642650-196642672 CCAGCTCCTGGTTCCAGGGCGGG - Intronic
968266004 3:197363921-197363943 CCAGCTTCTGACTCCTGGGCTGG - Intergenic
968291731 3:197544357-197544379 CAAGCTCCTGGCTCACTTGAGGG - Intronic
968654885 4:1774144-1774166 CCATGTCCTGGCTCATGGGAAGG + Intergenic
970709279 4:18842990-18843012 CCAGCCCATGGCTCCTGGGCTGG + Intergenic
979136676 4:117118778-117118800 CCAGCCCATGGCTCCTGGGCTGG + Intergenic
979532713 4:121786004-121786026 CAAGCATCTGGCTCATGTCCAGG - Intergenic
984134714 4:175921722-175921744 CAAGGTGATGGCTCATGGTCAGG - Intronic
985395443 4:189538718-189538740 GACGGTCCTGTCTCATGGGCAGG - Intergenic
1202765955 4_GL000008v2_random:148689-148711 CAATTCACTGGCTCATGGGCAGG - Intergenic
986740626 5:10702165-10702187 CCAGCGCCTGGCACATGGTCTGG + Intronic
988369143 5:30345234-30345256 CAAGCTTCTGGCTCAGGTGATGG - Intergenic
989153033 5:38319026-38319048 CATGCTCCAGGCTCATGAGATGG + Intronic
992008227 5:72500358-72500380 CAAGCTGCTGGCTCAGGGTAAGG - Intronic
992504958 5:77377739-77377761 CAAGCCCTTGGCTTATTGGCTGG - Intronic
992894200 5:81232897-81232919 CCAGCCCCTGGCTCAGGGCCCGG + Intergenic
997653653 5:135539714-135539736 CCTGCTCCTGGCTCTTGGGCAGG + Intergenic
998177129 5:139908783-139908805 TTAGTTCCTGGGTCATGGGCAGG + Intronic
1003253851 6:4457373-4457395 CAAGCCCCTGGCTCATGCTCTGG - Intergenic
1004286025 6:14321867-14321889 CAAGCTCCTTGTTAATGTGCAGG + Intergenic
1017440896 6:154463414-154463436 CAACCCACTGGCACATGGGCTGG + Intronic
1017658262 6:156650187-156650209 CAATCTGCTGGCTCAGGGGCTGG + Intergenic
1017959471 6:159209244-159209266 CACGCTCCAGGCTTCTGGGCTGG + Intronic
1017967807 6:159281495-159281517 CCAGCTCCTCACTCAGGGGCAGG + Intergenic
1019543406 7:1561333-1561355 CAGGCCCCTGGCTAATGGGTGGG + Intergenic
1019982877 7:4634320-4634342 AAAGCTCCTGACTCACAGGCTGG - Intergenic
1020910801 7:14128049-14128071 TAAGCTCCGGGGTCATGTGCAGG + Intergenic
1024088534 7:45917097-45917119 CCAGCGCCTGGCTGATGGGTGGG - Intronic
1025609858 7:63068415-63068437 CATGCTCCGGGCTCGGGGGCGGG - Intergenic
1025941172 7:66076950-66076972 CAAGCTTCTGGGTCATGGCAGGG + Intronic
1025941386 7:66078182-66078204 CAGGCTCCTGGCTGAGGGGCAGG + Intronic
1026123028 7:67554160-67554182 CAAGCTCCTGTATCATGCTCTGG + Intergenic
1026822093 7:73556937-73556959 CAAGCTCGCGGCGCAGGGGCCGG + Intronic
1029592289 7:101515074-101515096 AAAGCTCCTGCCCCGTGGGCAGG - Intronic
1030058540 7:105604103-105604125 AGAGCGCCTGGCTCAGGGGCAGG + Intergenic
1030948846 7:115763585-115763607 CCAGTCCCTGGCTCAAGGGCTGG + Intergenic
1032089907 7:128906299-128906321 CATGCTCCTGGCTCAGGGCAGGG + Exonic
1032092337 7:128917235-128917257 CATGCTCCTGGCTCAGGGCAGGG - Intergenic
1032783443 7:135182646-135182668 CAAGCCCAGGTCTCATGGGCTGG + Intergenic
1032822405 7:135536309-135536331 CAAGCACCTGGCTCAATGCCTGG - Intergenic
1033819410 7:145115777-145115799 CAAGGTCCTGGCACATGTGGAGG - Intergenic
1033945472 7:146711024-146711046 CAACCTCTTGGCTCAGGTGCTGG + Intronic
1035171482 7:157019617-157019639 CAACGCCCTGGCTCAGGGGCGGG + Intergenic
1035548259 8:500412-500434 CAAGCTCTGTGCTCATGGACAGG - Intronic
1039436464 8:37562818-37562840 CCAGCTCAAGTCTCATGGGCAGG + Intergenic
1041151934 8:54944178-54944200 CCAGCCCATGGCTCCTGGGCTGG + Intergenic
1042185753 8:66135008-66135030 CATGTTCCTCGCACATGGGCTGG - Exonic
1042811522 8:72830672-72830694 CATGCTTCTGGCTCATCAGCAGG + Intronic
1049409446 8:142465927-142465949 CACGCTCCTGTCTCATGAGCAGG - Intronic
1049416997 8:142499829-142499851 CAAGCTCCTGGCAGAAGGCCCGG - Intronic
1049559026 8:143298375-143298397 TAAGCTCCTGACCCCTGGGCCGG + Intergenic
1051536057 9:18159309-18159331 CAAGCTCATGTCTCATGGGTAGG - Intergenic
1052811182 9:33061964-33061986 CAAGCCCCTGGCACAGGGCCTGG + Intronic
1052846837 9:33344296-33344318 CTTGCTCCCGGCTCAGGGGCTGG + Intronic
1055835077 9:80430537-80430559 GCAGCTCCTGGCACATGGACAGG - Intergenic
1056257945 9:84819488-84819510 CAGGCTCCTGGGTCTTGGGGAGG + Intronic
1057800176 9:98186085-98186107 CAAACTCCAGGCTCAAGGCCAGG + Intronic
1057997717 9:99834630-99834652 CAAGCTTCTGGCTGAATGGCTGG + Intronic
1059308753 9:113374240-113374262 CAAGGCCCGGGCCCATGGGCTGG - Exonic
1061107723 9:128544847-128544869 AAAGCTCCTAGCACATGGGTGGG - Intergenic
1062200484 9:135300279-135300301 AAAGCTCCAGCCTCCTGGGCTGG + Intergenic
1062346034 9:136115778-136115800 CAGGCTCCCAGCTCAGGGGCTGG - Exonic
1203770493 EBV:47645-47667 CAGGCTCCTGGATCTGGGGCTGG + Intergenic
1203546706 Un_KI270743v1:133578-133600 CAATTCACTGGCTCATGGGCAGG - Intergenic
1185992497 X:4907132-4907154 CAAGCTGCCAGCTCTTGGGCTGG + Intergenic
1198091407 X:133334425-133334447 CAAGCTTCAGGCTCATGGGAGGG + Intronic
1200018800 X:153184876-153184898 GAAGCACCTGGCTCAGGGCCTGG - Intergenic