ID: 1076720265

View in Genome Browser
Species Human (GRCh38)
Location 10:132389361-132389383
Sequence CACTCACCAGTTCCTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076720256_1076720265 14 Left 1076720256 10:132389324-132389346 CCCTTGTCACTGTTGGAAGCTGG No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data
1076720255_1076720265 15 Left 1076720255 10:132389323-132389345 CCCCTTGTCACTGTTGGAAGCTG No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data
1076720259_1076720265 -9 Left 1076720259 10:132389347-132389369 CCCTGCACCCACTACACTCACCA No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data
1076720258_1076720265 13 Left 1076720258 10:132389325-132389347 CCTTGTCACTGTTGGAAGCTGGC No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data
1076720260_1076720265 -10 Left 1076720260 10:132389348-132389370 CCTGCACCCACTACACTCACCAG No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data
1076720254_1076720265 16 Left 1076720254 10:132389322-132389344 CCCCCTTGTCACTGTTGGAAGCT No data
Right 1076720265 10:132389361-132389383 CACTCACCAGTTCCTCCGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076720265 Original CRISPR CACTCACCAGTTCCTCCGTG GGG Intergenic
No off target data available for this crispr