ID: 1076721251

View in Genome Browser
Species Human (GRCh38)
Location 10:132394314-132394336
Sequence CTGTAGGCACAGCCGCAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076721251_1076721258 12 Left 1076721251 10:132394314-132394336 CCTTGCTGCGGCTGTGCCTACAG No data
Right 1076721258 10:132394349-132394371 AGGCTTTAGGACCTTTTGTTTGG No data
1076721251_1076721253 -8 Left 1076721251 10:132394314-132394336 CCTTGCTGCGGCTGTGCCTACAG No data
Right 1076721253 10:132394329-132394351 GCCTACAGCCAGAGGACCAAAGG No data
1076721251_1076721255 -1 Left 1076721251 10:132394314-132394336 CCTTGCTGCGGCTGTGCCTACAG No data
Right 1076721255 10:132394336-132394358 GCCAGAGGACCAAAGGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076721251 Original CRISPR CTGTAGGCACAGCCGCAGCA AGG (reversed) Intergenic
No off target data available for this crispr