ID: 1076722080

View in Genome Browser
Species Human (GRCh38)
Location 10:132397147-132397169
Sequence CACGCGCGGGGCTGACCCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076722068_1076722080 18 Left 1076722068 10:132397106-132397128 CCAGCGGAGCTTTGTGACGTCAG 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1076722066_1076722080 20 Left 1076722066 10:132397104-132397126 CCCCAGCGGAGCTTTGTGACGTC 0: 1
1: 0
2: 0
3: 6
4: 52
Right 1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1076722065_1076722080 23 Left 1076722065 10:132397101-132397123 CCGCCCCAGCGGAGCTTTGTGAC 0: 1
1: 0
2: 0
3: 6
4: 88
Right 1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1076722067_1076722080 19 Left 1076722067 10:132397105-132397127 CCCAGCGGAGCTTTGTGACGTCA 0: 1
1: 0
2: 0
3: 3
4: 41
Right 1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 83
1076722075_1076722080 -9 Left 1076722075 10:132397133-132397155 CCGCGGGGCGGCGTCACGCGCGG 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076722080 Original CRISPR CACGCGCGGGGCTGACCCGG CGG Exonic
900159650 1:1217455-1217477 CACCCGCGAGGCCGCCCCGGTGG + Exonic
900366032 1:2312384-2312406 GACACGCGGGGCTGAACCAGTGG - Intergenic
901671748 1:10860220-10860242 CTGGCCCGGGGCTGACACGGAGG + Intergenic
902861735 1:19251738-19251760 CACGCGAGGGGCAGCCCCCGAGG + Exonic
903072200 1:20732054-20732076 CAGGCGCGGGGCTGCGGCGGCGG - Intronic
910257179 1:85259695-85259717 CACGCGAGGGGCGGGCCCTGGGG - Intergenic
912927897 1:113929697-113929719 AGCGCGCGGGGCTGAGGCGGCGG + Exonic
916694511 1:167221636-167221658 CCCGCGCGGGGCTGAGCCCGGGG + Intronic
918511226 1:185316571-185316593 CGCGGGCGGGGATGACCCGCCGG - Intronic
923463947 1:234231823-234231845 CAGGCGCTGGGATGAGCCGGTGG + Intronic
1065373904 10:25017058-25017080 CAGGCGCAGAGCCGACCCGGAGG - Intronic
1066180751 10:32958417-32958439 CCCGGGCCGGGCTGACGCGGCGG - Intronic
1068335767 10:55630862-55630884 TGGGCGCGGGGCTGACCCTGCGG - Intergenic
1073289387 10:102405838-102405860 CAGGCCCGGGGCTGTCCTGGTGG - Intronic
1076374353 10:129973212-129973234 CACGCGCGGGGCTCCTCCGCGGG + Intergenic
1076722080 10:132397147-132397169 CACGCGCGGGGCTGACCCGGCGG + Exonic
1076793238 10:132787428-132787450 CGCGCTCGGGGCTGCCCCGGCGG + Intergenic
1076890471 10:133280833-133280855 CAGGCGCTGGGCTGAGCTGGGGG + Intronic
1076890494 10:133280903-133280925 CAGGCGCTGGGCTGAGCTGGGGG + Intronic
1077060365 11:615244-615266 CACGCGTGGGGCTGCCCTGCGGG + Exonic
1077419715 11:2444690-2444712 CACGAGCGGGGCTAAGCAGGTGG + Intronic
1077914705 11:6603739-6603761 CACGGGCGGGGCGGGGCCGGCGG + Intronic
1083267971 11:61555649-61555671 CATGGGCGTGGCTGAGCCGGTGG - Intronic
1087795553 11:102452392-102452414 AACGCTCGGGGCGGACCCAGAGG - Intronic
1089729567 11:120511852-120511874 CACTCCGGGGGCTGAGCCGGGGG - Exonic
1090344985 11:126062639-126062661 CGCGCGGGGGGATGACCTGGGGG - Intronic
1102431844 12:112890040-112890062 CATGCCTCGGGCTGACCCGGTGG - Exonic
1104929310 12:132329666-132329688 GGCGCGCGGGGCGGTCCCGGGGG - Intergenic
1108541988 13:51453351-51453373 CGCGCGCGGGGCGGCCGCGGCGG + Intronic
1113855677 13:113444256-113444278 CACTGGCCGGGCTGACCAGGAGG + Intronic
1122153506 14:99737263-99737285 CACGCCCCGTACTGACCCGGTGG + Intergenic
1122569234 14:102683567-102683589 CACCAGCGGGGCTTCCCCGGGGG + Intronic
1122917291 14:104865107-104865129 CACGCGCGGGGCTACCGGGGCGG + Intergenic
1128153451 15:65377546-65377568 CCCGCGCGGGGGGGACCCTGCGG - Intronic
1132186720 15:99807038-99807060 CTGGCGCGGGGCTGACTCGGGGG + Intergenic
1132428967 15:101745673-101745695 CTGGCGCGGGGCTGACTCGGGGG - Intronic
1133030829 16:3010233-3010255 TACGAGGGGGGCTGACCTGGTGG - Intergenic
1135407038 16:22206242-22206264 CAGGGGCGGGGCTGGCCTGGCGG - Intergenic
1139410096 16:66751809-66751831 CCCGCGCATGGCTGCCCCGGCGG - Intergenic
1142480488 17:215660-215682 CCCGCCCCGGGCTGACCCGAAGG - Exonic
1143174739 17:4949462-4949484 CACCCGCGGGGCTTAACAGGCGG + Intronic
1147184098 17:38704506-38704528 CACCCGCGGGGCTGGAGCGGAGG + Intergenic
1147931517 17:43984197-43984219 AAGGAGCAGGGCTGACCCGGAGG - Intronic
1150211911 17:63446390-63446412 CACGTGCGGGGCAGCCCCGGGGG - Intergenic
1150389389 17:64781661-64781683 CAGGCGCGGGCCTGGCCCAGAGG - Intergenic
1151328865 17:73395075-73395097 CACGCGCTTGGATGACCCTGAGG + Intronic
1152321494 17:79610677-79610699 CGCGGCCGGGGCTGACCCGAGGG - Intergenic
1153911199 18:9708097-9708119 CCCGCGCGGGGCTGGTCCGAGGG + Intergenic
1160999973 19:1905641-1905663 CGCGCGCGGCGCTGGCCTGGGGG + Intronic
1162857659 19:13481565-13481587 CAGCCGCTGGGCTGACCCTGGGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1166288919 19:41849237-41849259 CACGTGCGGGGCTGGCTAGGGGG - Exonic
1168336605 19:55600613-55600635 CAAGCGCGGGGCGGGCCCTGCGG - Intronic
933655239 2:84881210-84881232 TAGGCGCGGGGCTGACCTGCGGG - Exonic
934539087 2:95159682-95159704 CTGGCGCGGGGCGGACGCGGGGG - Intronic
934539096 2:95159705-95159727 CTGGCGCGGGGCGGACGCGGGGG - Intronic
934539105 2:95159728-95159750 CTGGCGCGGGGCGGACGCGGGGG - Intronic
934656035 2:96117121-96117143 CTCGCGCGGCGCTGGCCCGACGG - Intergenic
948115979 2:235494508-235494530 CAGGCGCGGGGCTGGCCCGCGGG - Exonic
948505733 2:238426110-238426132 CACTCGCGGGGCTGCGCCTGCGG + Intergenic
1170889746 20:20367690-20367712 CCCGCGCGGGGATTACCCGCGGG - Intergenic
1172359713 20:34303430-34303452 AACGCGCAGGGCGGAGCCGGAGG + Intronic
1172644479 20:36461390-36461412 CGCGCGCGCGGCTGACGCGGGGG + Intronic
1180074676 21:45456493-45456515 CCTGCTCGGGGCTGACCCCGAGG + Intronic
1180156961 21:45982543-45982565 CAGGCGCTGGGCTGGCCGGGAGG + Intronic
1181030520 22:20147149-20147171 CCCGCGTGGGGGTGCCCCGGCGG - Exonic
968653359 4:1768554-1768576 CACGCGTGTGGCTGGCCCTGCGG + Intergenic
968756404 4:2418392-2418414 GAGGCGCGGGGCGGACGCGGAGG + Exonic
969617669 4:8262920-8262942 GAAGGGCGGGGCTGACCCTGGGG - Intergenic
990438696 5:55821929-55821951 CACGGGCGGCCCTGACCCGGTGG + Intergenic
990910004 5:60843762-60843784 CCCGCGCGGCGCTGGCCCTGCGG - Intronic
997358156 5:133277724-133277746 CACGAGTGGGGCTGACTCTGGGG + Intronic
1003482488 6:6546360-6546382 CAGGCGCGCGGCTCTCCCGGCGG - Intergenic
1004516649 6:16327122-16327144 CACGCCCGCAGCTGACCTGGAGG - Exonic
1007631701 6:43276464-43276486 CACGCGCGGCGCCGCCACGGGGG + Intronic
1017174989 6:151494206-151494228 CGCGCGCGGGGGTGGCCCTGGGG + Intronic
1018978388 6:168582818-168582840 CACGCACGGGGAAGACCCGGGGG + Intronic
1020204541 7:6104894-6104916 CGGGCGCGGCGCTGACCCGGAGG + Exonic
1023773605 7:43583031-43583053 CAGGCGCGGGGCGGTCACGGGGG + Intronic
1029640808 7:101817567-101817589 CACGTGCGGGGCGGACCCTAAGG - Intronic
1030138641 7:106284365-106284387 AGCGCGCCGGGCTGGCCCGGGGG + Intronic
1032020652 7:128405695-128405717 CACGTGCAGGGCCGGCCCGGGGG + Intronic
1034324616 7:150219798-150219820 CGCGCGCGGGGCTCTCCCGCGGG - Intergenic
1034768578 7:153749433-153749455 CGCGCGCGGGGCTCTCCCGCGGG + Intergenic
1036733309 8:11284785-11284807 CCGGCGCGGGGCTGGCCCGTGGG - Exonic
1038326684 8:26577491-26577513 CCCACGCGGGGCTGCCGCGGCGG + Intronic
1046636513 8:116679359-116679381 CGGGCGGGGGGCTGACCGGGCGG - Intronic
1049184972 8:141245506-141245528 CTCCCCCAGGGCTGACCCGGGGG + Intronic
1053003523 9:34590482-34590504 CGCGCGAGGGGGTGACCGGGAGG - Intergenic
1061489938 9:130939223-130939245 CATGCGCGGGGCGGGCCCCGAGG + Intronic
1185469364 X:373516-373538 GGCGCGCGGGGCTGACCTGCTGG + Intronic
1186466379 X:9786807-9786829 GACGCGCGCGCCAGACCCGGGGG - Intronic
1190567290 X:51743691-51743713 CCCGCTCGGGGCCGACCCCGGGG - Exonic
1200233639 X:154458266-154458288 CACACACTGGGCTGGCCCGGGGG - Exonic