ID: 1076722761

View in Genome Browser
Species Human (GRCh38)
Location 10:132399948-132399970
Sequence CCTTTCCAGCAGTCTGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076722761_1076722766 11 Left 1076722761 10:132399948-132399970 CCAGACACAGACTGCTGGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1076722766 10:132399982-132400004 TCCTCTGTGAACCACACCCTAGG No data
1076722761_1076722769 24 Left 1076722761 10:132399948-132399970 CCAGACACAGACTGCTGGAAAGG 0: 1
1: 0
2: 0
3: 19
4: 208
Right 1076722769 10:132399995-132400017 ACACCCTAGGCCAGACACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076722761 Original CRISPR CCTTTCCAGCAGTCTGTGTC TGG (reversed) Intronic
901932098 1:12602397-12602419 CCTTTCTAGAAGTCTGTGGGAGG - Intronic
903775963 1:25794020-25794042 CCTTTCCAACGGTGAGTGTCAGG - Intergenic
904965869 1:34372129-34372151 CCTTGCCTGCAGTCTGATTCTGG - Intergenic
906202992 1:43971817-43971839 GCTTGCCAGCAGCCTGAGTCAGG - Exonic
907488587 1:54794265-54794287 CATTTCCTGCAGTTTCTGTCGGG - Intronic
915268106 1:154733028-154733050 CCTTTCCCACAGTATGTGTGGGG + Exonic
915595718 1:156895330-156895352 CCTCCCCAGCAGTGTGTGTCGGG - Intronic
917647511 1:177043812-177043834 CCTTGCCAGCAAGCTTTGTCTGG + Intronic
917745010 1:177998146-177998168 CCTTTCTGGCCCTCTGTGTCAGG + Intergenic
919105478 1:193145328-193145350 CTTTTCCAGCTGTTTGTGTGAGG + Intronic
919512448 1:198482125-198482147 TGATTCCAGCAGTTTGTGTCAGG + Intergenic
919861528 1:201741898-201741920 CCTGCCCAGAAGTCTGTTTCTGG - Intronic
921271467 1:213474113-213474135 CCTTCCCAGCAGTCTGTCCTTGG + Intergenic
921887991 1:220325615-220325637 CATTTCCAGCAGGCTGAGTAAGG + Intergenic
1063173871 10:3534449-3534471 CCTTTGCAGCAGACTGTGGTAGG + Intergenic
1064400003 10:15013320-15013342 CCTTTCCAGAACTCTGAGGCTGG + Intergenic
1064401853 10:15028110-15028132 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1065067153 10:21981686-21981708 CCTTTTCAGCAGACGGTGCCAGG + Intronic
1066149686 10:32602414-32602436 CTTTGTCAGAAGTCTGTGTCCGG - Intronic
1066366833 10:34784981-34785003 CATTTCCAGCAGTCTAAGGCAGG - Intronic
1067004122 10:42645428-42645450 CCTTTTAAGCAGTCAGTGGCCGG - Intergenic
1067270568 10:44788098-44788120 CTATTTCAGCAGGCTGTGTCTGG - Intergenic
1068663804 10:59651058-59651080 ACTTTCCAGAAGTCTGAGTGTGG + Exonic
1073108559 10:101047485-101047507 CTTTCCCAGCAGTCTGGGCCAGG + Intergenic
1076722761 10:132399948-132399970 CCTTTCCAGCAGTCTGTGTCTGG - Intronic
1076728227 10:132423662-132423684 GCTTTCCTGCAGTCTCTGTGTGG + Intergenic
1077337249 11:2010901-2010923 CCCTTCCTGCTGTCTGTGCCGGG + Intergenic
1082926306 11:58551064-58551086 CCTTCCCAGCAATCGGTTTCTGG + Exonic
1084163274 11:67362814-67362836 CCTTTCCAGCAGTCTTAGATGGG + Intronic
1084505461 11:69564082-69564104 CCTTTCCGGAAGTCTGTGGTGGG + Intergenic
1084580570 11:70020507-70020529 CCTTTCCAGCTGTCTGAGGGAGG - Intergenic
1085514373 11:77103807-77103829 CCTTTGCCGGAGCCTGTGTCTGG + Intronic
1088989032 11:114935532-114935554 ACTTCCCAGCAGTTTGAGTCTGG + Intergenic
1202820233 11_KI270721v1_random:66083-66105 CCCTTCCTGCTGTCTGTGCCGGG + Intergenic
1091447842 12:554107-554129 CCTTCCCAGGAGCCTGAGTCGGG - Intronic
1091791962 12:3277065-3277087 CCTTTCCAGCAAGCAGTGCCCGG + Intronic
1092435218 12:8441941-8441963 CCTTTCCAGAACTCTGAGGCTGG + Intergenic
1094830742 12:34299040-34299062 CCTTACCAGCAGCCTGTGCATGG + Intergenic
1094832829 12:34308291-34308313 CCTTCCCAGCAGTCCCTGTGCGG + Intergenic
1096609003 12:52788881-52788903 CCTTTCCAGCAGTCACCTTCTGG + Intergenic
1096777039 12:53970606-53970628 ACTTTCCAGAAGTCTCTGTTGGG + Intergenic
1097210749 12:57367215-57367237 CCTTTCCAGAAGTCTTTCTCTGG + Intronic
1098393813 12:69997176-69997198 TCTTTCCAGCAATTTGTGTAGGG + Intergenic
1098975568 12:76898723-76898745 TCTTTCCAGCACTCTGTGCCTGG - Intergenic
1099933979 12:89104263-89104285 CCTTTCCCCCAGTCTAAGTCAGG + Intergenic
1099973576 12:89524888-89524910 CCTATCCAGCGGTCTGGGCCTGG - Intronic
1100030862 12:90189232-90189254 GCTATCCAGCAGTATGTGACTGG - Intergenic
1103989734 12:124790847-124790869 CATTGCCAGCAGCCTGTGTGGGG - Intronic
1104558528 12:129823507-129823529 CCTTGCCAGCAGCCTTTGTAAGG + Intronic
1104899159 12:132178923-132178945 CCTCTCCTGCATTCCGTGTCTGG + Intergenic
1105213914 13:18273543-18273565 TCTTCCCAGCAGTCTGAGCCTGG - Intergenic
1105777341 13:23676147-23676169 TCTTTTCAGAAGTCTGTGTGAGG + Intergenic
1107048169 13:36016189-36016211 GCTTTCCATTAGTCTGTGCCTGG - Intronic
1107106718 13:36651305-36651327 CCTTTCCAACAGTGTGAGGCTGG + Intergenic
1107358260 13:39591710-39591732 CCTTCCCAGCAGTCTCTCTGGGG + Intronic
1107490278 13:40874888-40874910 CCTTTTAAGCAGTCAGTGGCTGG - Intergenic
1107579327 13:41765300-41765322 CCTTTCCAGTAGTCTGGGGAGGG - Intronic
1107733113 13:43368452-43368474 TCTTTCCAGCAATCTGTGCATGG + Intronic
1109348733 13:61148328-61148350 CCTTTACAGCAGCCTTTGTATGG + Intergenic
1111487291 13:88920240-88920262 GCTATCCAGCAGCCTGTCTCAGG - Intergenic
1113756749 13:112817616-112817638 CCTTCCCTGCAGACTGTGGCTGG + Intronic
1114419873 14:22572850-22572872 CCTTTCCAGAAGGCTCTATCAGG + Intronic
1114523464 14:23352818-23352840 CTCTTCGAGCTGTCTGTGTCCGG - Exonic
1115414644 14:33117341-33117363 GCTTCCCAGCAGTCAGTTTCAGG - Intronic
1115736668 14:36339091-36339113 CCTTTCCACCAGGCTTTCTCTGG + Intergenic
1118011191 14:61612302-61612324 ACTTTCCCCCAGTCTCTGTCAGG + Intronic
1119159607 14:72441937-72441959 CCTTTCCTGCAGGCTGCCTCGGG - Intronic
1119863145 14:77951505-77951527 CCTCTCCAGTAGCCTGTGCCTGG - Intergenic
1120917332 14:89721563-89721585 GCTTTCCATCAAGCTGTGTCGGG - Intergenic
1121441575 14:93953063-93953085 CCTTTCCTGCTCTCTGTGTGTGG + Intronic
1122967283 14:105137286-105137308 CCTTGCCAGCTGTCGGGGTCAGG + Intergenic
1125838678 15:42777563-42777585 CCTTTCCAGGTTTCAGTGTCAGG - Intronic
1127859998 15:62986004-62986026 TCTTTCCATCCGTCTGTCTCAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1130449523 15:84036841-84036863 CCTGTACAGCAGCCTGTGGCAGG + Exonic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1131932809 15:97464169-97464191 CCTTTCCACTAGCCTGTGTCAGG + Intergenic
1132679860 16:1135246-1135268 CCTGCCCAGCCGTCTGTGTGTGG - Intergenic
1133236498 16:4389620-4389642 CCTTCCCACCAGGCTGTGGCCGG + Intronic
1134537169 16:15035316-15035338 TCTCTCCACCAGTCTGTGGCAGG + Intronic
1135028429 16:19016627-19016649 CCTCCGCAGAAGTCTGTGTCTGG + Intronic
1136283885 16:29230251-29230273 CCATTCCAGCACTCTCTGTGTGG + Intergenic
1139182875 16:64768592-64768614 CTTTTTCAACAGTCTGTTTCAGG - Intergenic
1142088917 16:88199761-88199783 CCATTCCAGCACTCTCTGTGTGG + Intergenic
1142648120 17:1328563-1328585 TCCTTCCAGCAGTCTCTGTGGGG - Intergenic
1142648217 17:1329034-1329056 TCCTTCCAGCAGTCTCTGTGGGG - Intergenic
1145956964 17:28861319-28861341 CCCTTCCAGTAGTCTGCTTCAGG + Intergenic
1147988227 17:44318585-44318607 CCTCTCCATCTGTCTGTGTATGG + Exonic
1147998334 17:44373812-44373834 CCTTTCCAGTGGTATGTGTCTGG + Intronic
1153961954 18:10147597-10147619 CCTTTGCTGCAGTGAGTGTCCGG + Intergenic
1156336783 18:36179660-36179682 CCTTTGCATCCCTCTGTGTCGGG - Intronic
1156756287 18:40530742-40530764 CCTTAGCAGCATTCTGTGGCAGG - Intergenic
1159082616 18:63752687-63752709 CCTTTCCAACTGTGTGTGCCTGG - Intergenic
1160969663 19:1761962-1761984 CCTCTCCAGCAGCCTGTGCCAGG - Intronic
1162428536 19:10612558-10612580 CCTTCCCAGAAGTCTGTGCCTGG - Intronic
1163004366 19:14388441-14388463 CTGTTGCAGCATTCTGTGTCTGG + Exonic
1163063097 19:14774293-14774315 CTGTTGCAGCATTCTGTGTCTGG - Exonic
1163404149 19:17112227-17112249 CCTCTCCAGCAGGCTGCTTCGGG + Intronic
1165233866 19:34404852-34404874 CCTTTCCAGCGGGCTGGGGCGGG + Intronic
1165374492 19:35432171-35432193 CCTTTCCAGTGCTCTGTGTCTGG - Intergenic
1167117664 19:47497598-47497620 CCTTTCCAGCCCTCTGTGGGTGG - Intronic
926622522 2:15059842-15059864 CCTTTCCAGCAATTAGAGTCAGG + Intergenic
927360839 2:22230885-22230907 TTTTCCCAGCATTCTGTGTCTGG + Intergenic
934300412 2:91773206-91773228 TCTTCCCAGCAGTCTGAGCCTGG + Intergenic
934620164 2:95798791-95798813 CCTTGCCAACAGTCTGAGTGTGG + Intergenic
934640725 2:96025766-96025788 CCTTGCCAACAGTCTGAGTGTGG - Intronic
936809331 2:116377720-116377742 CCTTTCCAGGAAGATGTGTCAGG - Intergenic
938582486 2:132659612-132659634 CCCTTGCAGCAGTCAGTGACAGG + Intronic
939411937 2:141838929-141838951 CCTGGCCAGCAGTCTGCTTCAGG + Intronic
941989322 2:171539586-171539608 CCATCCCTCCAGTCTGTGTCAGG - Intronic
942242902 2:173980085-173980107 CCTTTACAACAGTCTGTTTTGGG - Intergenic
942786815 2:179709986-179710008 CCATTCCTGCACTTTGTGTCTGG - Intronic
944051648 2:195476700-195476722 CCTTTCCAGCAGTTTCTGGAGGG + Intergenic
944093218 2:195936745-195936767 CCTTTCCAGCATTCTGTCAATGG + Exonic
944463241 2:199974374-199974396 GCTTCCCATCAGCCTGTGTCCGG - Intronic
944503759 2:200388625-200388647 CCTTTCCTGTAGTCTTTTTCTGG - Intronic
948191811 2:236065059-236065081 CCTCTCCAGCAGTATCAGTCAGG - Intronic
949021460 2:241743348-241743370 CCTTTCCACGAGTGTGTGTGGGG + Intronic
1169015413 20:2288964-2288986 GCTTTCCAGCTCTCTGTGTATGG - Intergenic
1170532708 20:17310301-17310323 CCTTTCCCCCAGGCTCTGTCTGG + Intronic
1171774799 20:29355246-29355268 CCTTTCCAGCCCGCTGTCTCTGG + Intergenic
1173550074 20:43926820-43926842 CCTTGCTGGCAGGCTGTGTCAGG - Intronic
1174127685 20:48319300-48319322 CCTTTCCTACATCCTGTGTCTGG + Intergenic
1175126093 20:56752447-56752469 CCTTGCCAGCACTCTGAGCCTGG - Intergenic
1176185073 20:63773848-63773870 CCTTTCCAGGAGGCGGTGGCAGG - Intronic
1176515879 21:7783068-7783090 CCGTTCCACCTGTATGTGTCTGG + Intergenic
1176875681 21:14124658-14124680 CCTTTTAAGCTGTCAGTGTCCGG - Intronic
1176901795 21:14451178-14451200 CCTTTCCAGCAGACCTTCTCAGG + Intergenic
1178649907 21:34413080-34413102 CCGTTCCACCTGTATGTGTCTGG + Intergenic
1181698770 22:24608339-24608361 TCTTCCCAGCAGTCTGAGCCTGG + Intronic
1181796178 22:25312588-25312610 CCTTTACAGCAGTGTGAGACAGG - Intergenic
1181836725 22:25616198-25616220 CCTTTACAGCAGTGTGAGACAGG - Intronic
1183055128 22:35300384-35300406 CCTTCTCAGGTGTCTGTGTCCGG - Intronic
1183403143 22:37616662-37616684 CCCTGCCTGCAGTCTCTGTCTGG + Intronic
1184331176 22:43828929-43828951 CTTTTACAGCAGTCTGTAGCTGG - Intronic
1184556065 22:45233729-45233751 CATTTCCAGCAGCTTGGGTCTGG - Intronic
1184643644 22:45884965-45884987 CCTCTCCAGCTGTCAGTGACAGG - Intergenic
953970548 3:47343852-47343874 AATGTCCAGCAGTCTGTCTCTGG - Exonic
955148337 3:56342131-56342153 TCTTTCCAGCAGTCTGAGGCTGG + Intronic
961272373 3:125698869-125698891 CCTTTCCAGAACTCTGAGGCTGG - Intergenic
961278148 3:125743728-125743750 CCTTTCCAGAACTCTGAGGCCGG - Intergenic
961447100 3:126985960-126985982 CCTTCCCAGCAGACTTTGTTGGG + Intergenic
961628055 3:128277094-128277116 CCACACCTGCAGTCTGTGTCGGG + Intronic
962285135 3:134078948-134078970 CCTTTCTCCCAGTCTGTGGCTGG - Intronic
964616290 3:158670010-158670032 CAGATGCAGCAGTCTGTGTCTGG + Intronic
964750453 3:160049466-160049488 TCCTTCCAGCTGTCTATGTCAGG + Intergenic
966269352 3:178085793-178085815 CCTTCCAAGCTGTCTGTGACTGG + Intergenic
966415534 3:179686014-179686036 GGTTTCCAGCAGTCTGTGCATGG - Intronic
969659371 4:8517652-8517674 CCTTTCAAGAAGTCTGTCTTTGG + Intergenic
970345443 4:15148354-15148376 CCTTCACAGAAATCTGTGTCGGG - Intergenic
971053034 4:22882508-22882530 CCTTTCCAGAGGTGTGTGTATGG - Intergenic
971072791 4:23113757-23113779 CATTAGCAGCAGGCTGTGTCTGG + Intergenic
971272227 4:25160689-25160711 CCTTTCCTGAAGTTTGTGTCAGG - Intronic
976443853 4:85108106-85108128 CCTTTCTAGAATTCTGTGGCAGG - Intergenic
979735901 4:124083458-124083480 ACTTTCCAGAAGTTTGTGTTTGG - Intergenic
981688722 4:147482496-147482518 CATTTCCAGGAATCTGAGTCAGG - Intronic
981735142 4:147941539-147941561 CCTTGCCAGCAATATGTGTGAGG - Intronic
983706527 4:170667036-170667058 CTTTTCCAGTAGTCCGTGTGTGG - Intergenic
985540415 5:484905-484927 CCTATCCGGCCGTCTGTCTCAGG + Intronic
985770372 5:1806214-1806236 CCTCTCCACCTGTGTGTGTCAGG + Intronic
985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG + Intergenic
991017340 5:61946088-61946110 CCATTCCACCAGCCTCTGTCAGG + Intergenic
992226961 5:74628141-74628163 ACTTTCCAGCAGTCAGTCCCTGG - Exonic
993328071 5:86566454-86566476 CCTTTCCAGAACTCTGTGGTCGG + Intergenic
1001327311 5:170738575-170738597 CCTTTTCAGGTGCCTGTGTCAGG + Intergenic
1002098355 5:176845166-176845188 CCTCTCCAGCAGCCTGTTCCAGG + Intronic
1003221725 6:4166384-4166406 CCTTTCCCATAATCTGTGTCTGG - Intergenic
1004191747 6:13470277-13470299 CCATGCCAGCAGGCTGTGGCTGG + Intronic
1004284626 6:14309652-14309674 GCTTTCCAGCATTGTGTGACAGG - Intergenic
1008009902 6:46455456-46455478 CCATTGCTGAAGTCTGTGTCTGG - Intronic
1008673012 6:53793282-53793304 CCTTTCCACATGTCTCTGTCAGG + Intergenic
1011525909 6:88264486-88264508 CCTTTCTTCCATTCTGTGTCTGG + Intergenic
1013345238 6:109253770-109253792 CCTCTTCAGCAGTTAGTGTCTGG + Intergenic
1013638477 6:112050949-112050971 TCTTTCCAGCCGACTGTGTGTGG - Intergenic
1014144930 6:117986855-117986877 GATTTCCAGCAGCCTGTGTTGGG + Intronic
1016708876 6:147145979-147146001 CCTTTCCACCTGTCTGTTTATGG + Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1019614771 7:1954256-1954278 CCTTTCCCGCAGGCTGTCTTTGG - Intronic
1020031270 7:4934516-4934538 CGTTTCCAGCAGGCTGTGGCTGG + Intronic
1020057536 7:5128317-5128339 CCACTCCAGCAGCATGTGTCCGG - Intergenic
1022794676 7:33722592-33722614 CCCTGCCAGCAGCCTGGGTCAGG - Intergenic
1023098833 7:36691890-36691912 CCTTTCCAGCAGGTTGGCTCAGG - Intronic
1023897760 7:44448314-44448336 CCTTTTCATCAGTCTGTCTGTGG + Intronic
1024272701 7:47654703-47654725 ACTTCCTAGCAGTCTGTGGCTGG - Intergenic
1025016040 7:55439898-55439920 CCTGCCCAGCAGTCTGTGTTTGG - Intronic
1025250626 7:57349071-57349093 CCCTTCCAGCAGCCTCTGACCGG - Intergenic
1026461407 7:70618379-70618401 CCTCTCCAGCAGTCTCTCCCTGG + Intronic
1028557075 7:92135840-92135862 CCTTTTAAGCAGTTTGTGTTGGG - Intronic
1029099898 7:98120805-98120827 CCTTACCAGCAATCAGTGTCAGG - Intronic
1033509585 7:142041734-142041756 CCTTTCCAACATTCTTTGCCTGG + Intronic
1035068057 7:156122239-156122261 CCTTGCCAGAAATCTGTGCCTGG + Intergenic
1035484898 7:159215260-159215282 CATTTCCAGCAGTGGGTGTTGGG - Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1038935559 8:32246420-32246442 CCATACCAGCAGACTGAGTCAGG - Intronic
1042492802 8:69420023-69420045 CGTTTCTAGCAGTCTTTGACAGG + Intergenic
1043737321 8:83765087-83765109 CCTTTCCAGGAATTTGTTTCAGG - Intergenic
1044784311 8:95778454-95778476 CCATCCCAGCAGTCTGTGGCAGG + Intergenic
1044803060 8:95976856-95976878 CCTGCCCAGCAGTCTGTGCCAGG + Intergenic
1047689129 8:127332830-127332852 CCTTTCCTGGAGTCTATGCCTGG - Intergenic
1048964453 8:139605159-139605181 CTTTTCCACCAGTGTGTGTATGG - Intronic
1048987760 8:139744377-139744399 CCTTCCCAGCAGTCAGGGTCTGG - Intronic
1049068328 8:140337329-140337351 CTTTGCCTGCAGTCTGTTTCTGG - Intronic
1049207088 8:141368612-141368634 CCTCCCCAGCAGGCTGGGTCAGG - Intergenic
1049544886 8:143225961-143225983 CCTTCCCAGAACTCTGTGCCAGG + Intergenic
1051793235 9:20832704-20832726 CCTTCCCATCTTTCTGTGTCTGG + Intronic
1054159763 9:61665588-61665610 CCTTTTCCGGACTCTGTGTCGGG - Intergenic
1055698221 9:78912115-78912137 CTTTTCGAGCTGTCTTTGTCTGG - Intergenic
1057807699 9:98232288-98232310 CCTTTGGAGCAGTCAGTGCCTGG - Intronic
1059446078 9:114338841-114338863 CCCTTCCAGCTGTCTGACTCTGG - Intronic
1060176367 9:121499902-121499924 GCCTTCCAGCTGTCTGTGTCCGG - Intergenic
1060444631 9:123676903-123676925 TGTTTCCACCAGTCTGTGACAGG - Intronic
1060444830 9:123678289-123678311 CCTTGCCGTCAGTCTTTGTCTGG - Intronic
1060870169 9:127033617-127033639 CCTTTCCTCTAGTCTGTTTCAGG + Intronic
1060977166 9:127771474-127771496 CCTCCCCATCAGTCAGTGTCGGG + Intronic
1061146749 9:128804129-128804151 CCTTTCCACCCGTCTGTTCCTGG - Intronic
1061227566 9:129289564-129289586 CCTTTCCAGCCAGGTGTGTCAGG + Intergenic
1062274208 9:135723125-135723147 CCTCCCCAGCAGTCAGTGACGGG + Intronic
1062731841 9:138114254-138114276 CATTTCCAGGAGTCTTTGTGGGG + Intronic
1203777429 EBV:81590-81612 CCTGCCCCGCAGCCTGTGTCAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186981719 X:14964201-14964223 CCTTCCCAGAAGTCTGTGGCTGG - Intergenic
1187146321 X:16640472-16640494 CCTTTCTCTCAGTTTGTGTCTGG + Intronic
1188041310 X:25372513-25372535 CACTTCCAGCTGTCTGTGTCTGG - Intergenic
1190085279 X:47390050-47390072 CTTTTCCAGCACTCTTTTTCTGG + Intronic
1191117393 X:56866052-56866074 CCATTTCTGCAGTTTGTGTCTGG - Intergenic
1192808100 X:74527559-74527581 CCTTTCCAGCAGACTGTCCAGGG - Intronic
1201574436 Y:15446901-15446923 CCTTTTCAGCAGTGTCTGGCAGG - Intergenic
1201983535 Y:19934706-19934728 CTGTTCCATTAGTCTGTGTCTGG - Intergenic