ID: 1076722851

View in Genome Browser
Species Human (GRCh38)
Location 10:132400309-132400331
Sequence GAGTGGGTAAGGAGGGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076722838_1076722851 29 Left 1076722838 10:132400257-132400279 CCTGGCTAGCATGGCTGGTCTTC 0: 1
1: 0
2: 2
3: 18
4: 352
Right 1076722851 10:132400309-132400331 GAGTGGGTAAGGAGGGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076722851 Original CRISPR GAGTGGGTAAGGAGGGTGTG GGG Intronic
No off target data available for this crispr