ID: 1076723840

View in Genome Browser
Species Human (GRCh38)
Location 10:132404434-132404456
Sequence GTCCAACCCAGGACATACGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076723835_1076723840 22 Left 1076723835 10:132404389-132404411 CCATATGCTGCTTGGCTTTGGAA 0: 1
1: 0
2: 4
3: 23
4: 175
Right 1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1076723832_1076723840 27 Left 1076723832 10:132404384-132404406 CCCGGCCATATGCTGCTTGGCTT 0: 1
1: 0
2: 0
3: 12
4: 209
Right 1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1076723833_1076723840 26 Left 1076723833 10:132404385-132404407 CCGGCCATATGCTGCTTGGCTTT 0: 1
1: 0
2: 1
3: 18
4: 145
Right 1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1076723830_1076723840 30 Left 1076723830 10:132404381-132404403 CCTCCCGGCCATATGCTGCTTGG 0: 1
1: 0
2: 1
3: 3
4: 97
Right 1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG 0: 1
1: 0
2: 0
3: 3
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076723840 Original CRISPR GTCCAACCCAGGACATACGT AGG Intronic
907048038 1:51311986-51312008 GTCCATGCCAGGACACACATGGG - Intronic
916331808 1:163625806-163625828 GTGCAACCCTGGACACAAGTAGG - Intergenic
918018897 1:180665304-180665326 GTCCCACCCTTGACATTCGTGGG + Intronic
919381775 1:196869362-196869384 TTCCATCCCAGGACAGAGGTGGG - Intronic
923841654 1:237679084-237679106 GTGCACCCCAGGACAAACTTTGG - Intronic
923978123 1:239287987-239288009 GTCCAACTCAGGCCATATATGGG - Intergenic
1063515577 10:6691608-6691630 GTCCAGCCCAGGAGAAAAGTTGG - Intergenic
1065762362 10:28994217-28994239 GTCCTCCCCAGGACACACTTAGG - Intergenic
1066508715 10:36071514-36071536 AACCAACCCAGGACAGAGGTGGG - Intergenic
1076723840 10:132404434-132404456 GTCCAACCCAGGACATACGTAGG + Intronic
1077769864 11:5204887-5204909 GTCCAAGGCAGGACATGTGTGGG - Intergenic
1077959694 11:7062201-7062223 CTACAATCCAGGACATACATGGG - Intronic
1084166839 11:67379104-67379126 GTCCCACCCAGGACATTCCCTGG + Intronic
1092070477 12:5627472-5627494 GTCCAGCACAGGACATGGGTGGG - Intronic
1094656095 12:32420616-32420638 GTCCCAACCAGGAGATATGTGGG - Intronic
1102224381 12:111217529-111217551 GTCCATCCCAGGTCACACTTTGG - Intronic
1103628401 12:122238855-122238877 GTCCAATAAAGGAGATACGTGGG + Intronic
1117296720 14:54387078-54387100 ATCCCAAGCAGGACATACGTGGG - Intergenic
1128724953 15:69981584-69981606 ATCAAACCCAGGACTTACCTAGG - Intergenic
1132780374 16:1621213-1621235 GACCAACCCAGGACATGTGATGG + Intronic
1142901398 17:3014103-3014125 GTCTAGCCTAGGACACACGTCGG + Intronic
1142901406 17:3014162-3014184 GTCTAGCCTAGGACACACGTTGG + Intronic
1142901416 17:3014221-3014243 GTCGAGCCTAGGACACACGTCGG + Intronic
1149535936 17:57433363-57433385 GTCGAACCCAGGACACACATGGG + Intronic
1151856866 17:76727655-76727677 GTCCAACCCAAGAAACACTTTGG - Intronic
1155102449 18:22625592-22625614 TTCCAACCGAGGACAAAGGTAGG + Intergenic
1160374819 18:78403637-78403659 GTCCAGTCCAGGACAAAGGTGGG + Intergenic
1161488358 19:4547998-4548020 GTCCACCCCAGGCCAGCCGTGGG - Intronic
1161496132 19:4586884-4586906 GGCCAACCCAGGACACACATGGG - Intergenic
929979997 2:46669293-46669315 GTCCATCCCAGGACCTAAGAGGG + Intergenic
930369084 2:50481598-50481620 GTACAAACCAGCACTTACGTGGG + Intronic
932817721 2:74874986-74875008 ATCCATCCCAGGACATAGTTGGG - Intronic
934637849 2:96007217-96007239 GTCTAACCCAGGGTACACGTAGG + Intergenic
938263846 2:129912630-129912652 GTACAGCCCAGGACACATGTAGG + Intergenic
941876218 2:170436162-170436184 TTCCAACACAGGACACATGTTGG + Intronic
1170387162 20:15832043-15832065 GTCCGACAAAGAACATACGTAGG - Intronic
1174724784 20:52850330-52850352 GTCTTACCCAGGACATCTGTAGG - Intergenic
1176546813 21:8205797-8205819 GTCAACCCCAGGACACACGCGGG - Intergenic
1176554718 21:8250006-8250028 GTCAACCCCAGGACACACGCGGG - Intergenic
1176565764 21:8388844-8388866 GTCAACCCCAGGACACACGCGGG - Intergenic
1176573639 21:8433031-8433053 GTCAACCCCAGGACACACGCGGG - Intergenic
1183282248 22:36938033-36938055 GGCCAGCCCAGGACATAAGCTGG - Exonic
1203251688 22_KI270733v1_random:122082-122104 GTCAACCCCAGGACACACGCGGG - Intergenic
1203259738 22_KI270733v1_random:167164-167186 GTCAACCCCAGGACACACGCGGG - Intergenic
949172304 3:1015353-1015375 CTCCAACCCAGGCCACATGTGGG + Intergenic
958726433 3:97910888-97910910 GTCCAAACCAAGACATACTTAGG - Intronic
963182718 3:142376558-142376580 GTACAACCCAGGATATGTGTTGG - Exonic
980686939 4:136240888-136240910 GTCTAACCCAGGACAGTCATAGG + Intergenic
983264928 4:165498845-165498867 GTTTAACCCAGGATATATGTGGG - Intergenic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
1021682061 7:23143437-23143459 GTCCATTCCAGGAGATACGAAGG - Intronic
1023822923 7:43990094-43990116 GTCCAGCCTGGGACAGACGTGGG - Intergenic
1029751187 7:102543524-102543546 GTCCAGCCTGGGACAGACGTGGG - Intronic
1029769139 7:102642629-102642651 GTCCAGCCTGGGACAGACGTGGG - Exonic
1031915395 7:127558352-127558374 GTCTCTCCCATGACATACGTGGG - Intergenic
1035286257 7:157809296-157809318 ATCCAACCCTGGGCCTACGTGGG - Intronic
1035289603 7:157829449-157829471 GTGCACCGCAGGCCATACGTGGG + Intronic
1035316139 7:157998471-157998493 GTCCAACACAGCATCTACGTTGG - Intronic
1037695659 8:21221789-21221811 GTCCAACCCATCAAATACCTGGG - Intergenic
1040279077 8:46028924-46028946 GTCGACCCCAGGACACAAGTCGG + Intergenic
1040308138 8:46222872-46222894 ATCCCACCCAGGACAGACCTGGG - Intergenic
1047971751 8:130090663-130090685 GTCTAATGCAGGACACACGTGGG - Intronic
1048507450 8:135034077-135034099 GACCATCCCAGGACATGCCTGGG - Intergenic
1049619906 8:143593423-143593445 GTCCCACCCAGGACATGGGCTGG - Intronic
1053440894 9:38115520-38115542 GTCCCATCCAGGACAACCGTAGG + Intergenic
1055697727 9:78905224-78905246 GTCCAACAAAGGACCTAAGTAGG - Intergenic
1203468090 Un_GL000220v1:105233-105255 GTCAACCCCAGGACACACGCGGG - Intergenic
1203475911 Un_GL000220v1:149205-149227 GTCAACCCCAGGACACACGCGGG - Intergenic
1195928940 X:110053884-110053906 GCCCAGCCCAGGACATAAGCTGG - Intronic