ID: 1076724807

View in Genome Browser
Species Human (GRCh38)
Location 10:132408383-132408405
Sequence GCGGGGGTACCTGCCTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076724800_1076724807 5 Left 1076724800 10:132408355-132408377 CCTCTGGTCTGCTCTTTGTAGGG No data
Right 1076724807 10:132408383-132408405 GCGGGGGTACCTGCCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076724807 Original CRISPR GCGGGGGTACCTGCCTTTCC TGG Intronic