ID: 1076726342

View in Genome Browser
Species Human (GRCh38)
Location 10:132415931-132415953
Sequence GTGTGAGCATGAATGTAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 256}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076726342_1076726344 5 Left 1076726342 10:132415931-132415953 CCCTCTTACATTCATGCTCACAC 0: 1
1: 0
2: 0
3: 26
4: 256
Right 1076726344 10:132415959-132415981 TCCACCCTCACACTCTCACACGG No data
1076726342_1076726348 19 Left 1076726342 10:132415931-132415953 CCCTCTTACATTCATGCTCACAC 0: 1
1: 0
2: 0
3: 26
4: 256
Right 1076726348 10:132415973-132415995 CTCACACGGCACACGCCTGCAGG No data
1076726342_1076726349 30 Left 1076726342 10:132415931-132415953 CCCTCTTACATTCATGCTCACAC 0: 1
1: 0
2: 0
3: 26
4: 256
Right 1076726349 10:132415984-132416006 CACGCCTGCAGGTGCCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076726342 Original CRISPR GTGTGAGCATGAATGTAAGA GGG (reversed) Intronic
900646414 1:3710761-3710783 GTGTGTGCATGCATGTGGGAGGG - Intronic
901365944 1:8748351-8748373 GTGTGAGAGTGAATGACAGAGGG - Intronic
901799917 1:11702144-11702166 GTGTGAGCGTGAATGTGTGTGGG - Intronic
902828345 1:18992966-18992988 GGGTGGGCATGAATGGAAGAGGG - Intergenic
906245566 1:44271081-44271103 TTGTGTGCATGAAGGGAAGAGGG - Intronic
909193982 1:72593003-72593025 GTGAGAGCAAGAAAGTAATAGGG - Intergenic
909261482 1:73494870-73494892 GTGTGTGCATACATGTATGATGG + Intergenic
909323581 1:74320967-74320989 ATGTGAGGAGGAATGTGAGAAGG + Intronic
910169332 1:84360814-84360836 AAGTGAGCATGAAAGCAAGAGGG - Intronic
911220119 1:95236461-95236483 GTGAGTGGATGAATGCAAGAAGG - Intronic
912310732 1:108618416-108618438 GAGTGAGCATGAATGGAACAGGG + Intronic
912611541 1:111050763-111050785 GTGTGTCCTTGAATGTGAGATGG - Intergenic
913395666 1:118368819-118368841 TTTTCACCATGAATGTAAGAAGG + Intergenic
914243384 1:145867805-145867827 GGTTGTGCATGAATGTGAGAAGG - Intronic
915060403 1:153177445-153177467 GTGCTAGTATGAATGTAAGGTGG - Intergenic
916478378 1:165192185-165192207 CTGTTAACCTGAATGTAAGACGG - Intergenic
920276532 1:204809343-204809365 GTGTGTACATGCATGTGAGATGG + Intergenic
921917513 1:220628639-220628661 GTGTAAGAATGAATAGAAGAGGG - Intronic
924441868 1:244092920-244092942 GTGTGAACTTGAATGTGGGATGG - Intergenic
1063083957 10:2797631-2797653 CTGTTGGCATGAATGTAAAATGG + Intergenic
1063383375 10:5600766-5600788 GAATGAGCATGAAGGGAAGACGG + Intergenic
1063513665 10:6672386-6672408 TTGTGAGCATGCATGAAAAATGG - Intergenic
1064801199 10:19074436-19074458 GTGTGTGCATGAATTTGAAATGG + Intronic
1066239844 10:33522956-33522978 GTGTGAGGTTTAATGTCAGAAGG - Intergenic
1067338921 10:45385286-45385308 GGGTGAACATGAATGTCAGAGGG + Intronic
1068493463 10:57754453-57754475 GTGTGTGCATGCATGTCATAGGG + Intergenic
1070093264 10:73310616-73310638 CTGTGAGTGGGAATGTAAGAAGG - Intronic
1071018619 10:81027232-81027254 CTGTGAGCTTTAATGCAAGAAGG + Intergenic
1073973387 10:109071411-109071433 GTGTGTGCATGCATGTATAAAGG + Intergenic
1075921089 10:126214142-126214164 GTGTGAGCATTAAAACAAGAAGG + Intronic
1076726342 10:132415931-132415953 GTGTGAGCATGAATGTAAGAGGG - Intronic
1077965977 11:7134034-7134056 GAGAGAACATGAATGTCAGAAGG - Intergenic
1078718123 11:13858952-13858974 GTGGGAGCAGGCATGTAACATGG + Intergenic
1080018556 11:27533851-27533873 GTGTGTGCATGCATGTAATGAGG + Intergenic
1081994850 11:47357251-47357273 GTGTGAGCATGTATGTGAGCAGG - Intronic
1084367379 11:68711340-68711362 GTGTGTGCATGAGTGTATGTGGG + Intronic
1085643492 11:78208051-78208073 GTGAGAGCATGCATGAGAGAAGG + Intronic
1085844198 11:80046991-80047013 GTGAGAGCAGGAATGAAAGTTGG + Intergenic
1086472910 11:87134839-87134861 ATGCCAGCATGAATGTAAAATGG - Intronic
1087012950 11:93530543-93530565 CTGTGAGCATGAATGAAAGCAGG - Intronic
1088376089 11:109143187-109143209 GTATGAGAATTAAAGTAAGAAGG + Intergenic
1089034497 11:115372842-115372864 AGGTGAGCATGGATGAAAGAAGG + Intronic
1089081737 11:115781875-115781897 GAGTAAGCATTGATGTAAGAGGG + Intergenic
1091349456 11:134881407-134881429 GTGTTAGCTTGACTGTATGAAGG + Intergenic
1092697935 12:11194435-11194457 CTGTGTGTATGAATGTAATATGG + Intergenic
1095318901 12:40801483-40801505 TTGTGAGCATAAATTGAAGAAGG + Intronic
1095722151 12:45412559-45412581 ATGAGAGCATGAAGGGAAGAAGG - Intronic
1097370859 12:58779056-58779078 GTTTGAGCATGAATTTTGGAGGG - Intronic
1097876231 12:64646650-64646672 ATTTCAGCATGAATATAAGAGGG - Intronic
1098273139 12:68788472-68788494 GTCTCATGATGAATGTAAGATGG - Intronic
1098493191 12:71106041-71106063 ATGTGAGAGTGGATGTAAGAGGG + Intronic
1099096762 12:78383793-78383815 TTGTGAAGATGAATGGAAGAAGG + Intergenic
1100305323 12:93345012-93345034 GTGTGAGATGGAATGTAAGTGGG + Intergenic
1101352077 12:103939705-103939727 ATGTGACCATGAATATGAGATGG + Intronic
1102164847 12:110797892-110797914 ATGTGGGCATGGATGGAAGAGGG - Intergenic
1104090792 12:125515654-125515676 GTGTGAGAAAGAATGTGTGAAGG - Intronic
1104590736 12:130082923-130082945 ATGTGTGCATGAATGTATAATGG + Intergenic
1104899876 12:132183109-132183131 GGCTGAGCATGAGTGTCAGATGG + Intergenic
1105406889 13:20140628-20140650 GTGTGGGCATGGCTGGAAGACGG - Exonic
1105669959 13:22602420-22602442 ATGTGAGCATTAGTGTTAGAGGG + Intergenic
1105743525 13:23354485-23354507 GAGTGAACAGGAATGTTAGAAGG + Intronic
1106098986 13:26678644-26678666 GAGAGAGCAAAAATGTAAGATGG - Intronic
1107769908 13:43778718-43778740 GTCTGAGCATAAATAAAAGAAGG - Intronic
1108236628 13:48414906-48414928 GAGTGAGCATTAATGAAAAAAGG + Intronic
1110012865 13:70360638-70360660 GTGTGTGCATGTATGTATAATGG + Intergenic
1111233029 13:85369442-85369464 GTGTGAGGAGGAATTTAATATGG - Intergenic
1113304418 13:109061249-109061271 GTGGGCACACGAATGTAAGAAGG - Intronic
1116466920 14:45244636-45244658 TTGTGAACATGAATTTAAAATGG - Intronic
1116528983 14:45943890-45943912 GTGTGTGCATGCATATAAGTTGG + Intergenic
1125803525 15:42472365-42472387 ATGTGAAGATGAATGTAAGAAGG - Intronic
1126367206 15:47906573-47906595 GTGTAAGCAAGAAAGTAAGAAGG - Intergenic
1126858318 15:52860161-52860183 ATGGGAGGATGAATGTAGGAAGG + Intergenic
1127817399 15:62623438-62623460 GTATGCTCATGAATGTAAGTTGG - Intronic
1128491859 15:68155010-68155032 ATGTGAGCCTGTATGGAAGAGGG + Intronic
1128769035 15:70268208-70268230 GTAGAAGCATGCATGTAAGATGG + Intergenic
1131210108 15:90487688-90487710 GGGTGAGCATGAATGTAACTGGG + Intronic
1131839454 15:96420256-96420278 GTGTGAGCATGTATTAAATATGG - Intergenic
1132814881 16:1820919-1820941 GTGTCGGCATGAATGTTAGAGGG + Intronic
1133525045 16:6596900-6596922 GTGTGTGTATGAATGTATCAAGG - Intronic
1133909930 16:10056514-10056536 GAGTGAGCATGAATTTTTGAAGG - Intronic
1134449117 16:14353103-14353125 TGGTGTGAATGAATGTAAGACGG - Intergenic
1135308314 16:21385974-21385996 GTGTGTGTTTGTATGTAAGATGG + Intergenic
1136305058 16:29365109-29365131 GTGTGTGTTTGTATGTAAGATGG + Intergenic
1136987350 16:35120741-35120763 GTGGGGGCATGAATGAAAAATGG - Intergenic
1139109387 16:63870594-63870616 CTTTGAACATGAATTTAAGATGG - Intergenic
1141611415 16:85183224-85183246 GAGTGTGCATGAATGAGAGAGGG - Intronic
1143399415 17:6633429-6633451 TTGTCAGCAGGAATGTAAAACGG + Intronic
1144132119 17:12256168-12256190 CTGTGTGTAAGAATGTAAGAAGG - Intergenic
1145078062 17:19871417-19871439 GTGTGTGCATGTGTGTGAGATGG - Intergenic
1145780280 17:27558451-27558473 GTGTGCGCATGTATGTGAGCAGG - Intronic
1145789458 17:27617050-27617072 GGGTGAGCATGGATCTAAGAAGG + Intronic
1150199582 17:63340906-63340928 GCATGAGCATGAATGGGAGATGG - Intronic
1151127874 17:71864889-71864911 GAGTGAGCTTGACTGAAAGATGG - Intergenic
1152986607 18:327186-327208 GTGTGTGTGTGAATGTAAGATGG + Intronic
1153180981 18:2432719-2432741 GTGTGTGCATGTGTGTAGGATGG - Intergenic
1155612630 18:27684185-27684207 GGGTGGGAATGAATGGAAGAGGG - Intergenic
1156644530 18:39145201-39145223 ATCTGATCATGAATATAAGAAGG - Intergenic
1157957224 18:52111968-52111990 GTGGGAGCAGGAATGTCACATGG + Intergenic
1158348965 18:56545230-56545252 CTGTTAGCAAGAATGTAAAATGG + Intergenic
1158541556 18:58360768-58360790 GTGTGTACATGCATGCAAGAGGG + Intronic
1159137011 18:64348314-64348336 GGGTGAACATAAATGGAAGATGG + Intergenic
1159546223 18:69842207-69842229 GTGTAAGCAAAAATGTGAGAAGG + Exonic
1159667054 18:71174101-71174123 GTGGGAGAAAGAGTGTAAGATGG + Intergenic
1159943671 18:74427735-74427757 GTGTGAGCATGCGTGTGAGAAGG + Intergenic
1160332356 18:78006198-78006220 GTGTGAGGATGAATTGCAGAGGG + Intergenic
1160365506 18:78322233-78322255 GTGTGTGCCTGTATGTAAGCAGG - Intergenic
1160450605 18:78963035-78963057 GTGTGAGCATGTATGTGAGCGGG - Intergenic
1160962404 19:1729084-1729106 GTGTGTGCATGCGTGTGAGAGGG + Intergenic
1162970075 19:14175457-14175479 GTGTGAGCATGTGTGTGAGCGGG - Intronic
1165981519 19:39728354-39728376 GTGTGTGAGTGAATGTAAGGGGG - Intergenic
926785620 2:16515798-16515820 GTGTGAGAATGACTGTGAGCAGG - Intergenic
928830776 2:35479861-35479883 GTGTGTCCTTGCATGTAAGATGG - Intergenic
929655229 2:43724274-43724296 GAGTGAGCATAGATGGAAGAAGG + Intronic
931157270 2:59649470-59649492 TTGTGAGCAGGAATGGCAGATGG + Intergenic
931859918 2:66344327-66344349 GTTTGAACATGAAAGTGAGAAGG - Intergenic
932523660 2:72440784-72440806 GTGTGACACTGCATGTAAGATGG - Intronic
935267905 2:101410156-101410178 GTGTGAGCATGTGTGTAAGTGGG - Intronic
936287751 2:111194201-111194223 GTGAGTGCATGAATGAATGAAGG - Intergenic
936554788 2:113485964-113485986 GTGTCAGCATACATGGAAGAAGG + Intronic
937688930 2:124731806-124731828 GTGTGAGTGTGCATGTATGAGGG + Intronic
937913954 2:127089867-127089889 GTATGATCATGTAGGTAAGAGGG + Intronic
938193779 2:129307535-129307557 TTGTTCGCATGAATGTAAAATGG + Intergenic
939024301 2:136993846-136993868 GTGTGTGCATGAAAGACAGAAGG + Intronic
939565786 2:143785146-143785168 CTGTGTTCATGAATGTAAAATGG - Intergenic
940176904 2:150888119-150888141 GTGTGTGCATGCATGTGAGTTGG - Intergenic
940641871 2:156353390-156353412 GAGTGAGAATGCATGTAAGGGGG - Intergenic
940839882 2:158567949-158567971 GTTTGAGCCTGAATGAAAGAGGG + Intronic
941282489 2:163570779-163570801 GTTTCAGCATGAATTTTAGAGGG - Intergenic
942603566 2:177666496-177666518 TTGTTAGCAGGAATGTAAAATGG - Intronic
943249153 2:185494999-185495021 GTGTGAGCTTTAATTCAAGAAGG - Intergenic
945442179 2:209893614-209893636 GGGTGAGCATGAGTGTGAAATGG - Intronic
945579245 2:211572119-211572141 ATGTGAGCCTGAATTTAAGTAGG - Intronic
947588775 2:231372748-231372770 GTGTGTGTATGAGTGTATGAAGG + Intronic
1170464659 20:16611661-16611683 GAGTGAGCAGGAAGGGAAGATGG + Intergenic
1172303781 20:33867224-33867246 GTGTACACATGAGTGTAAGAGGG + Intergenic
1172397964 20:34623056-34623078 GAGTGAGCAGGAATGTAATGAGG + Intronic
1173547405 20:43909456-43909478 GTGTGTGTATGTATGTAGGAAGG + Intergenic
1174530161 20:51205594-51205616 GTGTGATAAGGAATTTAAGAAGG - Intergenic
1175474437 20:59260980-59261002 GTGTGTGTATGTATGTAAGGAGG - Intergenic
1175952942 20:62593139-62593161 GTGTGTGCATGCATGTATGGGGG + Intergenic
1177351039 21:19942036-19942058 GTGTCAGGATGAATGAATGAGGG - Intergenic
1177389288 21:20445781-20445803 GTGTGTGTGTGTATGTAAGAAGG + Intergenic
1177574713 21:22937590-22937612 ATGTGAGCATGAACATCAGAAGG - Intergenic
1177756345 21:25352834-25352856 GTGTGTGCATGCATGTGTGAAGG - Intergenic
1178708908 21:34896994-34897016 ATGTGTGCATGTGTGTAAGATGG + Intronic
1178895015 21:36550851-36550873 GGGTGAGCATGAATTTGGGAAGG - Intronic
1178994016 21:37380667-37380689 GAGTGAGCAGAAATGGAAGAGGG + Intronic
1181161164 22:20960748-20960770 GTGTGGGCAAGGAGGTAAGATGG - Intergenic
1182793686 22:32974652-32974674 GTGTGTGTGTGCATGTAAGAGGG + Intronic
1182904256 22:33921871-33921893 GTGTGAGAATGGATGGAAGGAGG + Intronic
1185079751 22:48703124-48703146 TTGTGAGCATGCATGTAAATGGG + Intronic
950572585 3:13811209-13811231 GTGAGAGCATGAGTGTGAGAAGG + Intergenic
951173600 3:19572941-19572963 GTGTGTGCATGAATGAATGCAGG - Intergenic
951409385 3:22343818-22343840 GTGTGAGAATGACTGTACAAGGG - Intronic
952168526 3:30778562-30778584 CTCTGAGCATGTATGTAAGCAGG - Intronic
952576193 3:34776836-34776858 GTGTGTGCATGTATGTGAGCTGG - Intergenic
953446116 3:42968897-42968919 GTGTGGGCAAGAGGGTAAGAGGG + Intronic
956149923 3:66230433-66230455 GTGTGTGCATGTATGTATGTAGG + Intronic
956367510 3:68520717-68520739 GTGTGATCATGCATGTAAAGTGG + Intronic
957633205 3:82745121-82745143 TAGTAACCATGAATGTAAGAGGG + Intergenic
957829341 3:85495722-85495744 GTGGGAGCATGCATGTCACATGG + Intronic
959597655 3:108145625-108145647 GGGTGAGCATGAATTTTGGAGGG - Intergenic
961638841 3:128352106-128352128 GTGTGTGCATGCATGTGTGATGG - Intronic
961781187 3:129321002-129321024 GTGTGAGCATGTGAGTAGGAGGG - Intergenic
962540237 3:136374229-136374251 GTGTGTGCCTGCATGTGAGATGG + Intronic
964181101 3:153887369-153887391 TTGTGAGCAGGAATGTAAAAGGG + Intergenic
965865742 3:173202501-173202523 GGGTGAGCAGGCATGTAACAAGG + Intergenic
966695807 3:182789843-182789865 GTGGGAGGATGAAGGTAGGAGGG - Intergenic
967482416 3:189988994-189989016 TTGTCAGCATGAATGTGTGAGGG - Exonic
968623171 4:1613475-1613497 GTTTGAACATGAATGTTGGAGGG + Intergenic
969334657 4:6500644-6500666 GTGTGACCAGGAAGGAAAGAGGG + Intronic
969361226 4:6665104-6665126 ATGTGAGCATGAGTGTCAGCGGG - Intergenic
970118261 4:12723526-12723548 GTGAGAACATGAAAGAAAGATGG + Intergenic
971681362 4:29705761-29705783 GAGAGAGAATGAATGTAAGCAGG + Intergenic
973110805 4:46395582-46395604 GTGTGTGCATGTGTGTAACAAGG - Intronic
975884952 4:78953916-78953938 GTATGAACATGAATGAAATATGG - Intergenic
976605349 4:86977497-86977519 GTGTGAGCATGTGTGTTAGGAGG + Intronic
977246653 4:94639376-94639398 TTGAGAGGATGAATGTAAGAAGG + Intronic
977900993 4:102422281-102422303 GTAAGATCATGAATCTAAGATGG - Intronic
979174034 4:117639148-117639170 TTGAGAGCAGGAATGTAAAAGGG - Intergenic
981171578 4:141631097-141631119 GTGGGAGCAGGAATGTCACATGG - Intergenic
983021974 4:162688465-162688487 ATGTGTGCATGAATGTATGTAGG - Intergenic
984062278 4:175004703-175004725 ATGTGTGCATGTATGTGAGAAGG + Intergenic
984624934 4:181996352-181996374 CTGTGAGCAGGAATGGATGATGG + Intergenic
986221861 5:5775543-5775565 GTGTGGGCCTGGAGGTAAGAGGG + Intergenic
987200994 5:15578021-15578043 GTGTGGTCATGGATGTAACACGG + Intronic
988145048 5:27294317-27294339 GTGTGTTCATGTATGTAAGCTGG - Intergenic
988185901 5:27861612-27861634 GTGTGTGCATGAAGGGAAGGGGG - Intergenic
988451747 5:31350882-31350904 GTATGAGAATGTATTTAAGAAGG + Intergenic
988713805 5:33804510-33804532 GTGTGAGCAAGAATAAATGATGG + Intronic
989563150 5:42873917-42873939 GTGTGTGAGTGTATGTAAGAGGG - Intronic
991658175 5:68923900-68923922 GTGTGAGCAGGAATGTGAGTTGG - Intergenic
993216780 5:85034551-85034573 ATGAGAGCATGAATGAATGATGG + Intergenic
993523745 5:88938504-88938526 GTGTGTGAATGAATGAAGGAAGG + Intergenic
993782061 5:92078464-92078486 GAATGATCATGAAAGTAAGATGG - Intergenic
993878833 5:93340011-93340033 GTGTGACCTTGAATATCAGAGGG + Intergenic
995622412 5:114040368-114040390 CTGTGAGCTTGAATTCAAGAAGG - Intergenic
995747615 5:115420029-115420051 GTGTGAGCAGAAATGTTAGCTGG - Intergenic
996254427 5:121381093-121381115 GAGAGAGAATGAATGCAAGAAGG + Intergenic
996284117 5:121769034-121769056 GTGGGAGCTTGCATGTCAGATGG - Intergenic
999623953 5:153500600-153500622 GTGTGTGTGTGTATGTAAGAGGG - Intronic
999866970 5:155711369-155711391 GTATGAGCATGAAATTATGAAGG - Intergenic
1001429237 5:171646416-171646438 GGGTGAGCCTGAAGGTAGGAAGG + Intergenic
1002852562 6:1009690-1009712 GTGTTAGTAGGAATGTAAAATGG - Intergenic
1002914880 6:1520998-1521020 GTGTTAGTAGGAATGTAACATGG - Intergenic
1003608203 6:7584750-7584772 GTGTGAGCAGGAATGTGAATGGG + Exonic
1004478595 6:15997897-15997919 GTGTGAGCATGAGAGTAAGCTGG + Intergenic
1005059857 6:21765648-21765670 ATGTGTTTATGAATGTAAGAAGG - Intergenic
1005107991 6:22246129-22246151 TTGTTAGTATGAATGTAAAATGG - Intergenic
1005200938 6:23343099-23343121 GTGGGAGCATGCAGGTAAGTGGG - Intergenic
1005270429 6:24157816-24157838 GTGTGTGTATGAGAGTAAGATGG - Intergenic
1007251367 6:40497344-40497366 GGGTGAGCAGGAATTTATGAGGG - Intronic
1008773368 6:55006924-55006946 GTGTGCCTTTGAATGTAAGATGG + Intergenic
1009195611 6:60680778-60680800 GTGTGAGCATGGTAGTATGATGG + Intergenic
1009335857 6:62490610-62490632 GTCTGTGTATAAATGTAAGAAGG - Intergenic
1009510364 6:64543824-64543846 GTTTTCGTATGAATGTAAGAGGG - Intronic
1010598556 6:77795372-77795394 GTGCATGCATGACTGTAAGAAGG - Intronic
1010742210 6:79521621-79521643 GTGTCAGTATGAATTTATGATGG + Intronic
1011311181 6:85981379-85981401 GCTTGAGCATGAATCTGAGACGG + Intergenic
1013656783 6:112254561-112254583 TGGTGAGAATGAATGTGAGAAGG - Exonic
1019601766 7:1887345-1887367 GTGTGAGCATGCATGTGTGTGGG + Intronic
1019601792 7:1887667-1887689 GTGTGAGCATGAATGCATGTGGG + Intronic
1019749341 7:2718962-2718984 GTATGAGCAGGAAGGAAAGAGGG + Intronic
1019829969 7:3318206-3318228 GTGTGTGCATGTTTGTAACAAGG - Intronic
1020392404 7:7672374-7672396 GTGTGAGCATGTGTGTATGAGGG + Intronic
1020905108 7:14054207-14054229 GTGTGAACATGAAAGTAGAAGGG + Intergenic
1023420868 7:39978173-39978195 GTGGGAGAATGAATATAGGAAGG + Intronic
1024117305 7:46206327-46206349 GTGTGAGGGTGAATGTGACATGG - Intergenic
1024634608 7:51276731-51276753 GAGTGAGCAGGCAGGTAAGAAGG + Intronic
1025827194 7:65020123-65020145 ATTTGAGCAAGAATGGAAGAAGG + Intergenic
1025914726 7:65856537-65856559 ATTTGAGCAAGAATGGAAGAAGG + Intergenic
1027178335 7:75919401-75919423 GTGTGTGTATGCATATAAGAGGG + Intronic
1027735566 7:81928445-81928467 GGGTGACCTTGAATGTGAGAAGG - Intergenic
1029373483 7:100164254-100164276 GTGTGTGTGTGCATGTAAGAGGG - Intronic
1030131515 7:106205720-106205742 GGGAAAGCATGGATGTAAGAAGG - Intergenic
1030720836 7:112868623-112868645 GTGTGAGCCTGAATTTGAAATGG - Intronic
1030953400 7:115820895-115820917 GGGCTAGCATGAATGTAAGGAGG + Intergenic
1031904483 7:127446075-127446097 CTGTGAGCTTTAATTTAAGAAGG + Intergenic
1034337538 7:150333185-150333207 GGGTGAGGATGAAAGGAAGAGGG + Intronic
1034897107 7:154883872-154883894 GTGTGAGCATGTATGTATGTGGG - Intronic
1035336763 7:158134299-158134321 GTGTGAGCATGTGTGTGAGAGGG - Intronic
1035969102 8:4227868-4227890 GTGTGGGGTTGAATGTAGGATGG - Intronic
1040960120 8:53022817-53022839 GTGTCAGCATCAATATGAGAAGG + Intergenic
1041453699 8:58034496-58034518 GTGTGGGCTTTAATGTTAGAAGG + Intronic
1041877495 8:62707042-62707064 GTGTGTGTATGTATGTATGATGG - Intronic
1044467487 8:92524832-92524854 GAGTGAGCTTTATTGTAAGATGG - Intergenic
1045760990 8:105607430-105607452 GTGTGAGAGTGAAAGTGAGAGGG - Intronic
1046352250 8:113031036-113031058 ATGCTAGCATGAATGTAAAATGG + Intronic
1047309048 8:123676879-123676901 GTGTGTGCATGCATGCAGGAAGG + Intergenic
1048100572 8:131346663-131346685 TATTGAGCATGAATCTAAGAGGG + Intergenic
1048871819 8:138805212-138805234 GTGTGTGCATGTGTGTGAGATGG + Intronic
1050671935 9:8007589-8007611 GAGGGAGCCTGAATGTTAGAAGG - Intergenic
1050687583 9:8189676-8189698 CTGTGAGCTTTAATTTAAGAAGG + Intergenic
1051049431 9:12913894-12913916 GTGAGAGTAACAATGTAAGAGGG + Intergenic
1051128960 9:13837288-13837310 CTGTGAGTAGGAATGTAAAATGG - Intergenic
1051534030 9:18136882-18136904 GTGTGAGGATGACTTAAAGAAGG + Intergenic
1051559346 9:18422895-18422917 CTGTGAGAAAGAATGTTAGAGGG - Intergenic
1051831023 9:21276858-21276880 GTGGAAGCATGAATCAAAGAAGG - Intergenic
1052440185 9:28486555-28486577 GTGTGTGCATGCATGTATGTGGG + Intronic
1053529812 9:38869468-38869490 ATGTGTGCCTGAGTGTAAGAAGG - Intergenic
1054202037 9:62093895-62093917 ATGTGTGCCTGAGTGTAAGAAGG - Intergenic
1054636320 9:67494464-67494486 ATGTGTGCCTGAGTGTAAGAAGG + Intergenic
1054959723 9:70954376-70954398 ATGTGAGAAGGAATGTGAGAAGG + Intronic
1057034380 9:91801078-91801100 GTGGGAGCAAAAATGTAAGTGGG - Intronic
1057436436 9:95044998-95045020 TTCTGAGCATGAATATAAAATGG - Intronic
1057642281 9:96836006-96836028 GTGAGAGCAGCAATGTAAGCTGG + Intronic
1057730412 9:97603387-97603409 GTGTGAGTATGAAGGAGAGAGGG - Intronic
1058527075 9:105869774-105869796 GTGTGTGCATGAGTGTGGGATGG + Intergenic
1059525234 9:114985063-114985085 GTGTGAGCATGTGTGGAAGAGGG + Intergenic
1060284778 9:122240012-122240034 CTGTGTGAATAAATGTAAGACGG - Exonic
1060748347 9:126152477-126152499 GTGAAATCATGAATGGAAGATGG - Intergenic
1061245125 9:129397634-129397656 ATGGGAGCATGAATGAAGGATGG + Intergenic
1062562735 9:137148981-137149003 GTGTGAGCAAGAGTGTTAGCAGG - Intronic
1186057058 X:5661094-5661116 GTGTGTGTATGTGTGTAAGAGGG + Intergenic
1187213300 X:17250720-17250742 GTTAGATCATGAATCTAAGATGG - Intergenic
1191589247 X:62862675-62862697 TTGTGATCATGAATTTAAAATGG - Intergenic
1192857081 X:75023685-75023707 GTGTGTCAATGTATGTAAGATGG + Intergenic
1194169721 X:90566162-90566184 GTGAGACCATGAATGTATGCCGG - Intergenic
1194307323 X:92264183-92264205 GTGTGAGAATTAATGGAAAATGG + Intronic
1194744775 X:97616429-97616451 GGGAGAGCATGAATGAAATATGG - Intergenic
1197436784 X:126438521-126438543 GTGTGTGCATGTGTGTAAAATGG - Intergenic
1197596415 X:128469533-128469555 GGGTGAGCATGAATCTGTGATGG - Intergenic
1201963012 Y:19702939-19702961 GTGTGTTCATGCATGTAAGAGGG + Intergenic