ID: 1076726546

View in Genome Browser
Species Human (GRCh38)
Location 10:132416645-132416667
Sequence CCCAGGCTCGGGTCTCCACG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076726526_1076726546 23 Left 1076726526 10:132416599-132416621 CCCATGCGTGGGGCTGTGTCCTG No data
Right 1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG No data
1076726525_1076726546 24 Left 1076726525 10:132416598-132416620 CCCCATGCGTGGGGCTGTGTCCT No data
Right 1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG No data
1076726537_1076726546 4 Left 1076726537 10:132416618-132416640 CCTGGTGGAGGGGGCTTGGGGCT No data
Right 1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG No data
1076726527_1076726546 22 Left 1076726527 10:132416600-132416622 CCATGCGTGGGGCTGTGTCCTGG No data
Right 1076726546 10:132416645-132416667 CCCAGGCTCGGGTCTCCACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076726546 Original CRISPR CCCAGGCTCGGGTCTCCACG GGG Intronic