ID: 1076728898

View in Genome Browser
Species Human (GRCh38)
Location 10:132428665-132428687
Sequence CCCTCCTACCTCTCCAAAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076728898_1076728903 1 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728903 10:132428689-132428711 TCCAAGCGGACTTCGAGGACAGG No data
1076728898_1076728905 2 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728905 10:132428690-132428712 CCAAGCGGACTTCGAGGACAGGG No data
1076728898_1076728907 24 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728907 10:132428712-132428734 GAGCCTCAGCAGTGTGGCCCTGG No data
1076728898_1076728902 -4 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG No data
1076728898_1076728906 18 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728906 10:132428706-132428728 GACAGGGAGCCTCAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076728898 Original CRISPR CCCTCCTACCTCTCCAAAGG CGG (reversed) Intergenic