ID: 1076728902

View in Genome Browser
Species Human (GRCh38)
Location 10:132428684-132428706
Sequence AGGGCTCCAAGCGGACTTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076728898_1076728902 -4 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG No data
1076728900_1076728902 -7 Left 1076728900 10:132428668-132428690 CCTTTGGAGAGGTAGGAGGGCTC No data
Right 1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076728902 Original CRISPR AGGGCTCCAAGCGGACTTCG AGG Intergenic
No off target data available for this crispr