ID: 1076728906

View in Genome Browser
Species Human (GRCh38)
Location 10:132428706-132428728
Sequence GACAGGGAGCCTCAGCAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076728898_1076728906 18 Left 1076728898 10:132428665-132428687 CCGCCTTTGGAGAGGTAGGAGGG No data
Right 1076728906 10:132428706-132428728 GACAGGGAGCCTCAGCAGTGTGG No data
1076728904_1076728906 -7 Left 1076728904 10:132428690-132428712 CCAAGCGGACTTCGAGGACAGGG No data
Right 1076728906 10:132428706-132428728 GACAGGGAGCCTCAGCAGTGTGG No data
1076728900_1076728906 15 Left 1076728900 10:132428668-132428690 CCTTTGGAGAGGTAGGAGGGCTC No data
Right 1076728906 10:132428706-132428728 GACAGGGAGCCTCAGCAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076728906 Original CRISPR GACAGGGAGCCTCAGCAGTG TGG Intergenic