ID: 1076736360

View in Genome Browser
Species Human (GRCh38)
Location 10:132460936-132460958
Sequence GCTGCAGGTCAGGCAGAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1076736360_1076736369 21 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736369 10:132460980-132461002 CTCTCCATGCCCTTGGAGCCTGG No data
1076736360_1076736364 -4 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736364 10:132460955-132460977 CAGCTCCATTAGGTCCTAGCAGG No data
1076736360_1076736371 23 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736371 10:132460982-132461004 CTCCATGCCCTTGGAGCCTGGGG No data
1076736360_1076736370 22 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736370 10:132460981-132461003 TCTCCATGCCCTTGGAGCCTGGG No data
1076736360_1076736367 14 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736367 10:132460973-132460995 GCAGGACCTCTCCATGCCCTTGG No data
1076736360_1076736372 24 Left 1076736360 10:132460936-132460958 CCAGGCTCTGCCTGACCTGCAGC No data
Right 1076736372 10:132460983-132461005 TCCATGCCCTTGGAGCCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1076736360 Original CRISPR GCTGCAGGTCAGGCAGAGCC TGG (reversed) Intergenic
No off target data available for this crispr